Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,040

0 members and 1,040 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Jchipowsky (44)

» Stats

Members: 75,945
Threads: 249,144
Posts: 2,572,366
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 31

Threaded View

  1. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Breeder jumped down my throat at Tinley...

    Quote Originally Posted by pbenner View Post
    If he is right, then I have been ignorant for too long, and if he's wrong, I need to know I am right.
    Fairly certain I know who you are talking about and while I am not defending his behaviour I will just say that is his personality. Assuming it was who I think then I am guessing he quite likely butchered any explanation he has heard in the past, most of which he got from me (guessing my name may have been one of those he tossed out as well), again, because that is his personality.


    To answer your question about co-dom... Give this a listen, it should help you


    http://www.blogtalkradio.com/morelia...tic-roundtable
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (03-18-2019),pbenner (03-18-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1