Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,393

0 members and 1,393 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,936
Threads: 249,129
Posts: 2,572,284
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 19

Threaded View

  1. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: BP morph ID please?

    Quote Originally Posted by Roux View Post
    I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it.
    Just a point of clarification, that pairing does not guarantee "without a doubt" that the animal is a Spotnose. There is, for any given offspring, a 1:4 chance of it not having the Spotnose gene.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    dr del (03-02-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1