» Site Navigation
2 members and 1,477 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,936
Threads: 249,129
Posts: 2,572,284
Top Poster: JLC (31,651)
|
-
Registered User
Re: BP morph ID please?
I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it. They even have pictures of the full clutch after hatching ect.
I see no reason to doubt the morphs they listed for your snake.
Sent from my SM-N960U using Tapatalk
-
The Following User Says Thank You to Roux For This Useful Post:
-
Registered User
Re: BP morph ID please?
 Originally Posted by Roux
I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it. They even have pictures of the full clutch after hatching ect.
I see no reason to doubt the morphs they listed for your snake.
Sent from my SM-N960U using Tapatalk
Roux saves the day.
-
-
Re: BP morph ID please?
 Originally Posted by Roux
I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it. They even have pictures of the full clutch after hatching ect.
I see no reason to doubt the morphs they listed for your snake.
Sent from my SM-N960U using Tapatalk
I did not even think to do that! You’re amazing!
Thank you so much, very relieved to know when I breed in a couple years I have the possibility of getting a super GHI.
_______________________________________

_______________________________________
-
-
Registered User
Re: BP morph ID please?
Very glad i could help! i go to the extreme when researching... morph market really provides a lot of info if you dig for it!
Sent from my SM-N960U using Tapatalk
-
-
I have a HRA and the stripe down the back looks like mine. It's pretty distinctive.
thats a pretty snake.
~Sunny~
Booplesnoop Coilsome, Odyn, & Eeden AKA theLittleOne
0:1 Pastel Het Red Day Chocolate
1:0 Normal
0:0:1 Pueblan milk snake
*~* Nothing sticky (tape, stick on gauges, Velcro) goes into your enclosure! Again...NOTHING sticky goes into your enclosure....EVER! *~*
-
-
Re: BP morph ID please?
 Originally Posted by Shadowy
KDF Reptiles LLC. Breeder in Texas. I do trust the breeder but after looking at other BPs with GHI I was questioning it.
Kevin is a good dude and one I would not hesitate to do business with. Also, if you'll look at the pics you provided you'll notice that at the back of the head right before the stripe begins on the neck there is a little light colored "dash" running length wise. All of the Spotnose GHI's I've hatched or seen as well as combo's like spotnose lesser ghi have that marking.
-
-
Re: BP morph ID please?
 Originally Posted by Mr.Spence
Kevin is a good dude and one I would not hesitate to do business with. Also, if you'll look at the pics you provided you'll notice that at the back of the head right before the stripe begins on the neck there is a little light colored "dash" running length wise. All of the Spotnose GHI's I've hatched or seen as well as combo's like spotnose lesser ghi have that marking.
Thank you! I wasn’t questioning him to begin with. He really seemed like he knew his stuff when I bought from him. After posting a picture on reddit and few people pointed out she looked like a normal, I just had to make sure. Shame on me for listening to people on reddit. Lol
_______________________________________

_______________________________________
-
-
Re: BP morph ID please?
 Originally Posted by Roux
I looked up the breeders fb page, and that particular snake you have came from a pairing that was spotnose ghi to spotnose hra. Without a doubt your snake has spotnose in it.
Just a point of clarification, that pairing does not guarantee "without a doubt" that the animal is a Spotnose. There is, for any given offspring, a 1:4 chance of it not having the Spotnose gene.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: BP morph ID please?
 Originally Posted by asplundii
Just a point of clarification, that pairing does not guarantee "without a doubt" that the animal is a Spotnose. There is, for any given offspring, a 1:4 chance of it not having the Spotnose gene.
My mistake, you are indeed correct. Should have double checked myself before saying so.
Sent from my SM-N960U using Tapatalk
-
The Following User Says Thank You to Roux For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|