Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,090

1 members and 1,089 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Jchipowsky (44)

» Stats

Members: 75,945
Threads: 249,145
Posts: 2,572,367
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 10
  1. #1
    Registered User silverbill's Avatar
    Join Date
    09-22-2016
    Location
    Ontario, Canada
    Posts
    168
    Thanks
    87
    Thanked 175 Times in 75 Posts

    Day old chicks for ball pythons

    I picked up a few day old chicks at the past expo since they were significantly cheaper than rats. They’re about the size of a weaned rat. I wasn’t sure if my ball pythons would eat them but thought it would be fun to try. Interestingly enough, both my smaller <500g balls took them right away but the adults >1000g were definitely not interested.

    So what’s the verdict on chicks for ball pythons? Are they healthy as a meal? I’ve heard they’re quite nutritious but I’ll be sticking to mainly rats for now with the occasional chick as a treat.

  2. #2
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,946
    Thanks
    893
    Thanked 4,181 Times in 1,552 Posts
    Images: 120

    Re: Day old chicks for ball pythons

    I've been told that the post-digestive odor is a limiting factor: Probably not on a small collection though.
    *.* TNTC

  3. #3
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Day old chicks for ball pythons

    Quote Originally Posted by Lord Sorril View Post
    I've been told that the post-digestive odor is a limiting factor: Probably not on a small collection though.
    I haven't fed my collection birds but have experienced the after effects of a friend's retic eating whole chickens. The poop was really watery and made me gag and I've cleaned up some nasty stuff before. With something as picky as a BP, I'd be worried they'd get hooked and only want birds so that may be an issue if you don't have a steady supply. As for nutrition, I don't know the specifics so I can't speak on that.

    Sent from my Pixel 3 using Tapatalk

  4. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    I will pass on the runny smelly poop , not to mention that while the size of a rat calcium wise because they are so young their bone is basically rubber), calcium deficiency could be a serious issue even more so is you decide to breed some of your animal.

    So as a treat yes (also hopefully they will not imprint on it, as picky as BP are that could be a frustrating issue) as a staple diet I would not recommend it.
    Last edited by Stewart_Reptiles; 11-27-2018 at 02:16 PM.
    Deborah Stewart


  5. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    the_rotten1 (11-27-2018)

  6. #5
    BPnet Veteran Danger noodles's Avatar
    Join Date
    10-15-2018
    Location
    Houston
    Posts
    740
    Thanks
    107
    Thanked 545 Times in 349 Posts
    I was thinking about trying one out. Let me know how it goes op. Lol

  7. #6
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    I've given my male BPs chicks before. It does make the poop runny, but I never noticed any negative impact on the health of my snakes. I never fed them chicks for more than half of their meals, and only fed chicks for a period of 3-4 months total, so I can't attest to long term results. But as a short term treat they're fine.


    Some balls are more eager to eat them than others. I only had a few take them without scenting, most needed me to rat scent them before they would accept them, but that was while feeding f/t. If you have live chicks they will probably take those a little more eagerly.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  8. #7
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Day old chicks for ball pythons

    Quote Originally Posted by silverbill View Post
    I picked up a few day old chicks at the past expo since they were significantly cheaper than rats. They’re about the size of a weaned rat. I wasn’t sure if my ball pythons would eat them but thought it would be fun to try. Interestingly enough, both my smaller <500g balls took them right away but the adults >1000g were definitely not interested.

    So what’s the verdict on chicks for ball pythons? Are they healthy as a meal? I’ve heard they’re quite nutritious but I’ll be sticking to mainly rats for now with the occasional chick as a treat.
    All I know is I took a couple of Royals as a favour then he said they only eat day old chicks .. I fed them the ones he gave me but they looked so beautiful ..
    Sounds gruesome but I snipped all their heads and legs off and then it was just like feeding little balls of fluff ... then switched them to rats soon after


    Sent from my iPhone using Tapatalk Pro




  9. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I find it interesting that people say feeding bird gives snakes runny stool. I have a number of snakes (bredli, blackhead, chondro, kukri, beaked, hognose) that frequently eat chicks and quail and I have never noticed their stool to be runnier than my balls...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #9
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Day old chicks for ball pythons

    Quote Originally Posted by asplundii View Post
    I find it interesting that people say feeding bird gives snakes runny stool. I have a number of snakes (bredli, blackhead, chondro, kukri, beaked, hognose) that frequently eat chicks and quail and I have never noticed their stool to be runnier than my balls...
    I think it's just a case of when you suddenly and drastically swap someone's diet ..

    I recall us feeding 180 dogs some tinned vegetarian dog food for the first few time ( the dog sanctuary had been given a free batch by Linda McCartney.) ..

    It came out much quicker than it went in


    Sent from my iPhone using Tapatalk Pro




  11. #10
    BPnet Veteran Starscream's Avatar
    Join Date
    06-29-2017
    Location
    Missouri
    Posts
    987
    Thanks
    1,221
    Thanked 1,263 Times in 629 Posts
    Images: 1
    I've noticed the runny stools with day-old chicks, but not with quail. I was wondering if it was because the quail were more developed, but if the comments in this thread are anything to go by, it may just be chickens lol.
    0.1 Red Axanthic P. regius | Mazikeen
    0.1
    E. climacophora | Lan Fan


Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1