» Site Navigation
0 members and 753 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,142
Posts: 2,572,364
Top Poster: JLC (31,651)
|
-
Day old chicks for ball pythons
I picked up a few day old chicks at the past expo since they were significantly cheaper than rats. They’re about the size of a weaned rat. I wasn’t sure if my ball pythons would eat them but thought it would be fun to try. Interestingly enough, both my smaller <500g balls took them right away but the adults >1000g were definitely not interested.
So what’s the verdict on chicks for ball pythons? Are they healthy as a meal? I’ve heard they’re quite nutritious but I’ll be sticking to mainly rats for now with the occasional chick as a treat.
-
-
Re: Day old chicks for ball pythons
I've been told that the post-digestive odor is a limiting factor: Probably not on a small collection though.
-
-
Re: Day old chicks for ball pythons
 Originally Posted by Lord Sorril
I've been told that the post-digestive odor is a limiting factor: Probably not on a small collection though.
I haven't fed my collection birds but have experienced the after effects of a friend's retic eating whole chickens. The poop was really watery and made me gag and I've cleaned up some nasty stuff before. With something as picky as a BP, I'd be worried they'd get hooked and only want birds so that may be an issue if you don't have a steady supply. As for nutrition, I don't know the specifics so I can't speak on that.
Sent from my Pixel 3 using Tapatalk
-
-
I will pass on the runny smelly poop , not to mention that while the size of a rat calcium wise because they are so young their bone is basically rubber), calcium deficiency could be a serious issue even more so is you decide to breed some of your animal.
So as a treat yes (also hopefully they will not imprint on it, as picky as BP are that could be a frustrating issue) as a staple diet I would not recommend it.
Last edited by Stewart_Reptiles; 11-27-2018 at 02:16 PM.
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
I was thinking about trying one out. Let me know how it goes op. Lol
-
-
I've given my male BPs chicks before. It does make the poop runny, but I never noticed any negative impact on the health of my snakes. I never fed them chicks for more than half of their meals, and only fed chicks for a period of 3-4 months total, so I can't attest to long term results. But as a short term treat they're fine.
Some balls are more eager to eat them than others. I only had a few take them without scenting, most needed me to rat scent them before they would accept them, but that was while feeding f/t. If you have live chicks they will probably take those a little more eagerly.
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!

-
-
Re: Day old chicks for ball pythons
 Originally Posted by silverbill
I picked up a few day old chicks at the past expo since they were significantly cheaper than rats. They’re about the size of a weaned rat. I wasn’t sure if my ball pythons would eat them but thought it would be fun to try. Interestingly enough, both my smaller <500g balls took them right away but the adults >1000g were definitely not interested.
So what’s the verdict on chicks for ball pythons? Are they healthy as a meal? I’ve heard they’re quite nutritious but I’ll be sticking to mainly rats for now with the occasional chick as a treat.
All I know is I took a couple of Royals as a favour then he said they only eat day old chicks .. I fed them the ones he gave me but they looked so beautiful ..
Sounds gruesome but I snipped all their heads and legs off and then it was just like feeding little balls of fluff ... then switched them to rats soon after
Sent from my iPhone using Tapatalk Pro
-
-
I find it interesting that people say feeding bird gives snakes runny stool. I have a number of snakes (bredli, blackhead, chondro, kukri, beaked, hognose) that frequently eat chicks and quail and I have never noticed their stool to be runnier than my balls...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Day old chicks for ball pythons
 Originally Posted by asplundii
I find it interesting that people say feeding bird gives snakes runny stool. I have a number of snakes (bredli, blackhead, chondro, kukri, beaked, hognose) that frequently eat chicks and quail and I have never noticed their stool to be runnier than my balls...
I think it's just a case of when you suddenly and drastically swap someone's diet ..
I recall us feeding 180 dogs some tinned vegetarian dog food for the first few time ( the dog sanctuary had been given a free batch by Linda McCartney.) ..
It came out much quicker than it went in 
Sent from my iPhone using Tapatalk Pro
-
-
I've noticed the runny stools with day-old chicks, but not with quail. I was wondering if it was because the quail were more developed, but if the comments in this thread are anything to go by, it may just be chickens lol.
0.1 Red Axanthic P. regius | Mazikeen
0.1 E. climacophora | Lan Fan
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|