Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 611

1 members and 610 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 25

Thread: White Snakes

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: White Snakes

    Quote Originally Posted by Turbo Serpent View Post
    Almost every super or ALS created from the BlkEL or BluEL has the ability to be "pure" white, but can also have pattern.
    I will disagree with you here, there are some combos within each group that will never be pure white (like SuperPhantom or SuperVanilla).


    Quote Originally Posted by Turbo Serpent View Post
    not sure what dictates the bleed through of the pattern in some but not others.
    It is determined by the "strength" of the allele(s) you are working with, "stronger" alleles (e.g., more highly expressed mutation) will give reduce the likelihood of patterning/colouring arising. Lesser is stronger than Mojave is stronger than Phantom and so SuperLesser is less patterned/coloured than SuperMojave is less patterned/coloured than Phantom.


    Quote Originally Posted by JodanOrNoDan View Post
    I am getting ready to do a bucket of white snakes picture. Waiting on one to come out of the egg. No two of the same combo. Will be interesting to see the opinions on the "whitest".
    This will be interesting to see however I think you already know my caution that what these animals look like as hatchlings can be very different to how they look as adults. What people say is the "whitest" at 100g could look very different at 1000g.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Ronniex2 (07-25-2018),the_rotten1 (08-13-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1