Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,674

1 members and 1,673 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,104
Threads: 249,252
Posts: 2,572,980
Top Poster: JLC (31,651)
Welcome to our newest member, GarlandFbj
Results 1 to 10 of 31

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I believe that Ryan Young has bred them, not sure on his availability at the moment.

    And once upon a time Tom Keogan was breeding them. You might try and track him down
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Craiga 01453 (05-16-2018),redshepherd (05-16-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1