Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 553

1 members and 552 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 8 of 8

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    It is not a wood frog, look at the toes, it is in the tree frog family.

    Given it was found in a nursery I would guess it is a one or the other of the so-called "greenhouse frog", either Eleutherodactylus planirostris or Eleutherodactylus coqui. They are infamous for colonizing greenhouses and getting transported all around because they bury their eggs in the pots where they skip the tadpole stage and direct develop into baby frogs.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    ROSIEonFIRE (05-02-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1