» Site Navigation
0 members and 1,201 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
|
-
Re: Reptilinks!!!???
 Originally Posted by DennisM
I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
I get the whole “variety” and “treat” thing. But the exorbitant costs put a lid on it for me.
I love Lobster and Prime Rib, but haven’t had either in over 20 years. I just can’t justify the cost.
The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.
1.2 Coastal Carpet Pythons
Mack The Knife, 2013
Lizzy, 2010
Etta, 2013
1.1 Jungle Carpet Pythons
Esmarelda , 2014
Sundance, 2012
2.0 Common BI Boas, Punch, 2005; Butch, age?
0.1 Normal Ball Python, Elvira, 2001
0.1 Olive (Aussie) Python, Olivia, 2017
Please excuse the spelling in my posts. Auto-Correct is my worst enema.
-
The Following User Says Thank You to Reinz For This Useful Post:
-
Re: Reptilinks!!!???
 Originally Posted by DennisM
I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
They work well for lizards that need a variety of whole prey and veggies in their diet, especially the ones that tend to pick out the foods they like and leave the rest.
Also some snake owners's significant others don't care to look at a package of mice or rats in the freezer when they go digging for a package of ground beef.
-
The Following User Says Thank You to bcr229 For This Useful Post:
-
I have heard second hand issues with these. Is there any documented cases of snakes having impaction or digestive problems with these? I take almost every second hand story as someone who has no idea what they are doing grasping at straws to blame why their snake died but I have read several complaints about these so I am curious. I know they are fabulous for lizards that tear and rip their prey apart but for snakes that swallow whole is what I am wondering about.
1.0 ♂ 2010 Spider BP 'Dante'
1.0 ♂ 2017 Bay of LA Rosy Boa 'Queso'
0.0.1 2017 Aru GTP 'Ganja'
1.0 ♂ Blue Tick Coonhound 'Blue'
1.0 ♂ 2018 Basset Hound 'Cooper'
-
-
Re: Reptilinks!!!???
 Originally Posted by DennisM
I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
I want to offer it simply for variety in my snakes' diets. It wouldnt be a staple. Since my little boas are too small to eat stuff like chicks, quails and rabbits, a link here and there i believe would be a good change.
 Originally Posted by SDA
I have heard second hand issues with these. Is there any documented cases of snakes having impaction or digestive problems with these? I take almost every second hand story as someone who has no idea what they are doing grasping at straws to blame why their snake died but I have read several complaints about these so I am curious. I know they are fabulous for lizards that tear and rip their prey apart but for snakes that swallow whole is what I am wondering about.
I couldnt imagine how a Reptilink would cause impaction. It's not wet sand or a giant piece of undigestible material. A snake's stomach digests bone, i think it digest a sausage casing. And not all lizards tear their prey unless it is too big. My Nile monitor used to just swallow mice and small rats lol. Big stuff he would hold them in his mouth and then use his claw to rip them open and then drag them around all proud. That made for a big mess. My Savannahs used to just swallow stuff too. My beardie also would just swallow the links.
Last edited by Sauzo; 04-17-2018 at 04:30 PM.
0.1 Rio Bravo Pokigron Suriname BC-Gina
1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie
0.1 Biak Green Tree Python-Pat
1.0 OSHY Biak Green Tree Python-Alex
0.0.1 Super Reduced Reticulated Gila Monster-Dozer
0.0.1 Utah Banded Gila Monster-Tank
0.0.1 Super Black Beaded Lizard-Reggie
-
-
Re: Reptilinks!!!???
 Originally Posted by asplundii
I have been using ReptiLinks for about three years now. I feed them to my BHP, bredli, GTP, hognose, and occasionally my GBKs. And I just picked up a couple new species this weekend that I will also try these on once they settle in.
All in all I like them. I have a variety of different types; frog, guinea fowl, quail, quail/frog, rabbit, iguana, megablend... Might have one or two others, cannot recall off the top of my head... For species that are not normally rodent feeders in the wild I feel these are a preferable food source as it more closely mimics what they would be eating. And gram for gram I feel they have better nutrition as well and so I have to feed less frequently.
How do you thaw them and heat for feeding? You mention feeding less frequently based on nutritional value, could you please explain?
 Originally Posted by John1982
I've been using them for a couple years now to add variety for some of my snakes. Sometimes harder hitting animals will create a mess and sometimes the ends aren't tied off well so one side will be unravelled after thawing. Some of my harder hitting/chewing stuff can equally rip a f/t rodent in half so I'm used to cleaning after feeding anyway, haha. All in all, I like them for what they are and will continue using. Nothing I keep gets them as a staple but I've always got a few packages in the freezer so I can mix things up. Success varies but far less than half of my snakes turn down links. I do tend to offer them stuff they'd naturally be interested in in the wild though. I'm not tossing rabbit links at garter snakes, etc.
How do you thaw them and heat for feeding?
 Originally Posted by Sauzo
Not sure how big your BHPs are or what their equivalent in rat weight is but Caesar usually eats about 360ish gram rat. Rosey gets around a 275-300 gram rat and Vicky gets a 250 gram rat. I'll see though as i probably will put in a small order of 25 gram rabbit and quail and chicken ones for the little boas and some quail mini links for Pat. Might do a single order of the 100 gram rabbit and quail to see how big they are. Worst case, I'm sure Vicky can eat them.
I remember reading somewhere and asked asplundii about the less frequent feeding based on nutritional value vs whole prey items.
Ball Python
0.1 Lesser (Lucille) local pet store
Boas
0.1 Caulkers Cay (CC) from TJ Blevins (Second City Constrictors)
1.0 Sunglow het moonglow (Sonny) from Dustin Dirnberger
1.0 BCI - DH Sharp Snow (Bob) from TJ Blevins (Second City Constrictors)
1.0 Brazillian Rainbow Boa (Babylon) from Ike Lightener (Ike's Exotics & Aquatics)
Pythons
0.0.1 Unknown/undocumented rescue (Roger)
1.0 Northern White Lip (Solo)
Cats
1.1 Domestic short hair (Esther and James)
Snake Wishlist
Drymarchon Malanurus (Black Tail Cribno)
SD/D Retic
Woma or Black Headed Python
Other Reptile Wishlist
Poison dart frogs
-
-
Re: Reptilinks!!!???
 Originally Posted by DennisM
I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
Variety and convenience. I can buy rabbit/quail/frog/etc links, whole chicks, whole quail, quail eggs, whole rats, whole mice in 1 shipment/box. Their whole prey prices are pretty much on par with my other frozen feeder suppliers so about twice a year(when I'm low on links) I go ahead and make an order from them and restock all feeders plus several bags of links. I'm usually restocking other feeders every 2-3 months.
-
The Following User Says Thank You to John1982 For This Useful Post:
-
Re: Reptilinks!!!???
 Originally Posted by BR8080
How do you thaw them and heat for feeding?
No different from thawing rodents. Use your preferred method.
Last edited by John1982; 04-18-2018 at 06:21 AM.
-
The Following User Says Thank You to John1982 For This Useful Post:
-
When i fed them to my beardie, i would just toss them into a baggie and float them in warm water until thawed just like rodents.
As for higher nutritional value, i might be an idiot but i dont see how they would be higher than whole prey. I see them as being equal since really the only difference you are doing is grinding up whole prey. Sure you skip the feathers in the case of birds but i dont see that as adding that much more. A 100 gram link would equal 100 grams of whole prey worth of food unless i am missing something.
The main reason i want to try them is to just give variety to my smaller snakes.
0.1 Rio Bravo Pokigron Suriname BC-Gina
1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie
0.1 Biak Green Tree Python-Pat
1.0 OSHY Biak Green Tree Python-Alex
0.0.1 Super Reduced Reticulated Gila Monster-Dozer
0.0.1 Utah Banded Gila Monster-Tank
0.0.1 Super Black Beaded Lizard-Reggie
-
-
Re: Reptilinks!!!???
 Originally Posted by Sauzo
Not sure how big your BHPs are or what their equivalent in rat weight is but Caesar usually eats about 360ish gram rat. Rosey gets around a 275-300 gram rat and Vicky gets a 250 gram rat.
My BHP is 2 meters long, about as big around as a soda can. I do not weigh my rats but she can down a medium and not have a noticeable bulge.
 Originally Posted by DennisM
I'm curious why one would choose to feed these rather than whole prey animals.
As I said above, these allow me to feed my animals a diet closer to what they would be eating in the wild which I feel is better for them. BHPs, bredli, GTPs, GBKs, hognose... None of these animals evolved eating European-domestic rodents and a captive diet composed of them is not exactly the best for them, this is part of the reason why we see such a problem with obesity and FLD in a lot of these species. And, these are whole prey so it is not a "rather than" situation.
 Originally Posted by BR8080
You mention feeding less frequently based on nutritional value, could you please explain?
 Originally Posted by Sauzo
As for higher nutritional value, i might be an idiot but i dont see how they would be higher than whole prey. I see them as being equal since really the only difference you are doing is grinding up whole prey... A 100 gram link would equal 100 grams of whole prey worth of food unless i am missing something.
Nick has done a few podcasts and discussed this in detail but in short -- If you look at a typical whole prey item, about 20-30% of that item is intestines full of predigested and fecal matter, they pull most of that out (basically from the bottom of the stomach down). By using links you gain back that 20-30% in "useful" material. Additionally, because the material in ReptiLinks is ground, it is digested more easily and the nutrients are absorbed better than versus whole prey. All of this together makes ReptiLinks more calorie dense than rodents so feeding the same gram weight is providing higher calories and you can feed less often.
 Originally Posted by SDA
I have heard second hand issues with these. Is there any documented cases of snakes having impaction or digestive problems with these? I take almost every second hand story as someone who has no idea what they are doing grasping at straws to blame why their snake died but I have read several complaints about these so I am curious.
I have never had any issues with impaction and I have not heard any first-hand accounts of this...
 Originally Posted by BR8080
How do you thaw them and heat for feeding?
I take whatever I need to feed for the week out of the freezer, put it in a Ziplock bag and throw it in the bucket of hot water that I am using to thaw out my F/T rats in.
 Originally Posted by cron14
Not to railroad the thread but, has anyone tried the ASF scent to get a picky eater on f/t? I’ve always fed live but have been trying the last few months to make the switch for convienence. Hes still healthy and I’m fine to feed live if this goes on much longer but wanted to know if anyone has had some success. I’d say the last time I offered f/t he showed the most interest so I feel like I’m close.
I have all their scents, mostly for some obscure species I am working with to help me get things feeding, have not used the fish one yet but the frog, lizard, and gecko ones have proven useful for me. I have used the ASF scent on a rat a couple times for a ball that I picked up and was told was eating rats only to find out it was on ASFs. It seems to spark a bit of interest but he has only taken 1 of the 4 rats I have done this with so jury is still out.
Last edited by asplundii; 04-18-2018 at 09:04 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Reptilinks!!!???
 Originally Posted by asplundii
I have used the ASF scent on a rat a couple times for a ball that I picked up and was told was eating rats only to find out it was on ASFs. It seems to spark a bit of interest but he has only taken 1 of the 4 rats I have done this with so jury is still out.
Live or f/t rats?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|