Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 667

1 members and 666 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,103
Posts: 2,572,096
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 31
  1. #11
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,567
    Thanks
    2,968
    Thanked 9,997 Times in 4,836 Posts
    Images: 34

    Re: Reptilinks!!!???

    Quote Originally Posted by tttaylorrr View Post
    i always say if my Corn ever refuses a meal, it's an emergency trip to the vet!!!

    but about Reptilinks: omg really? that's awesome! i'm actually on the hunt for proper sized feeders for my growing (severely underfed) Corn; do you keep Corns? do you have experience feeding these to Corns?
    Corn snakes apparently do very well on them.

    They do have a Facebook group if you want to ask the owner or other customers questions: https://www.facebook.com/groups/TheLinkSide/

  2. The Following User Says Thank You to bcr229 For This Useful Post:

    tttaylorrr (04-14-2018)

  3. #12
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts
    I can see how these could be useful for hognose hatchlings, as they make tiny ones out of frog meat.

  4. The Following User Says Thank You to Alter-Echo For This Useful Post:

    Craiga 01453 (04-17-2018)

  5. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have been using ReptiLinks for about three years now. I feed them to my BHP, bredli, GTP, hognose, and occasionally my GBKs. And I just picked up a couple new species this weekend that I will also try these on once they settle in.

    All in all I like them. I have a variety of different types; frog, guinea fowl, quail, quail/frog, rabbit, iguana, megablend... Might have one or two others, cannot recall off the top of my head... For species that are not normally rodent feeders in the wild I feel these are a preferable food source as it more closely mimics what they would be eating. And gram for gram I feel they have better nutrition as well and so I have to feed less frequently.

    Some animals can be difficult to get feeding, I have this problem with my GBKs actually as they seem to imprint harder than balls on a food item, but for those that are enthusiastic eaters or are not finicky you should have no problems. And I have had some balls that will take these as well, though I do not feed them links on the regular (and again, it is the ones that have such a strong feed response that they would literally eat a rat that was still frozen).

    If you have easy access to them then I would suggest at least trying them on some of your animals for a while and seeing how they work for you.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    BR8080 (04-18-2018),Sauzo (04-16-2018)

  7. #14
    BPnet Royalty John1982's Avatar
    Join Date
    08-13-2010
    Location
    Florida
    Posts
    4,009
    Thanks
    2,496
    Thanked 2,962 Times in 1,669 Posts
    I've been using them for a couple years now to add variety for some of my snakes. Sometimes harder hitting animals will create a mess and sometimes the ends aren't tied off well so one side will be unravelled after thawing. Some of my harder hitting/chewing stuff can equally rip a f/t rodent in half so I'm used to cleaning after feeding anyway, haha. All in all, I like them for what they are and will continue using. Nothing I keep gets them as a staple but I've always got a few packages in the freezer so I can mix things up. Success varies but far less than half of my snakes turn down links. I do tend to offer them stuff they'd naturally be interested in in the wild though. I'm not tossing rabbit links at garter snakes, etc.










  8. The Following 4 Users Say Thank You to John1982 For This Useful Post:

    AbsoluteApril (04-17-2018),BR8080 (04-18-2018),Sauzo (04-16-2018),Sonny1318 (04-17-2018)

  9. #15
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts
    Yeah i was going to give it a shot since yesterday was feeding day for the little booger Pat but the reptile shop doesnt carry them anymore I'll probably have to order a small sample to try on the little boas and Pat. I dont think a 100g link is going to make a dent in Caesar or the big boas. Would be like a tic tac to them.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  10. #16
    BPnet Senior Member Sonny1318's Avatar
    Join Date
    07-02-2014
    Location
    Chicago
    Posts
    2,262
    Thanks
    4,720
    Thanked 1,538 Times in 1,148 Posts
    Images: 9
    Has anybody had any luck feeding these to Ball pythons? I was just curious.

  11. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by Sauzo View Post
    I dont think a 100g link is going to make a dent in Caesar or the big boas. Would be like a tic tac to them.
    You might be surprised. I feed 100g links to my 2m BHP and she does fine with them.

    Quote Originally Posted by Sonny1318 View Post
    Has anybody had any luck feeding these to Ball pythons? I was just curious.
    As I noted in my earlier post, I have a couple balls that will take them but it is the ones that are of the bite first/think later mindset. If you have a ball like that then you might have success, but if you have a ball that requires you do the 5 minute zombie rat dance then odds are it will not take them
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. The Following User Says Thank You to asplundii For This Useful Post:

    Sonny1318 (04-17-2018)

  13. #18
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by asplundii View Post
    You might be surprised. I feed 100g links to my 2m BHP and she does fine with them.
    Not sure how big your BHPs are or what their equivalent in rat weight is but Caesar usually eats about 360ish gram rat. Rosey gets around a 275-300 gram rat and Vicky gets a 250 gram rat. I'll see though as i probably will put in a small order of 25 gram rabbit and quail and chicken ones for the little boas and some quail mini links for Pat. Might do a single order of the 100 gram rabbit and quail to see how big they are. Worst case, I'm sure Vicky can eat them.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  14. #19
    Registered User cron14's Avatar
    Join Date
    02-15-2016
    Posts
    150
    Thanks
    106
    Thanked 87 Times in 60 Posts
    Images: 6

    Re: Reptilinks!!!???

    Not to railroad the thread but, has anyone tried the ASF scent to get a picky eater on f/t? I’ve always fed live but have been trying the last few months to make the switch for convienence. Hes still healthy and I’m fine to feed live if this goes on much longer but wanted to know if anyone has had some success. I’d say the last time I offered f/t he showed the most interest so I feel like I’m close.

  15. #20
    BPnet Veteran DennisM's Avatar
    Join Date
    07-19-2014
    Posts
    907
    Thanks
    104
    Thanked 571 Times in 379 Posts
    Images: 24
    I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.

  16. The Following User Says Thank You to DennisM For This Useful Post:

    Reinz (04-17-2018)

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1