Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 631

1 members and 630 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,109
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 31

Threaded View

  1. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by Sauzo View Post
    I dont think a 100g link is going to make a dent in Caesar or the big boas. Would be like a tic tac to them.
    You might be surprised. I feed 100g links to my 2m BHP and she does fine with them.

    Quote Originally Posted by Sonny1318 View Post
    Has anybody had any luck feeding these to Ball pythons? I was just curious.
    As I noted in my earlier post, I have a couple balls that will take them but it is the ones that are of the bite first/think later mindset. If you have a ball like that then you might have success, but if you have a ball that requires you do the 5 minute zombie rat dance then odds are it will not take them
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Sonny1318 (04-17-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1