Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,482

0 members and 1,482 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 31
  1. #21
    BPnet Lifer Reinz's Avatar
    Join Date
    08-05-2013
    Location
    East TX
    Posts
    8,019
    Thanks
    5,613
    Thanked 4,602 Times in 3,139 Posts
    Images: 9

    Re: Reptilinks!!!???

    Quote Originally Posted by DennisM View Post
    I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
    I get the whole “variety” and “treat” thing. But the exorbitant costs put a lid on it for me.

    I love Lobster and Prime Rib, but haven’t had either in over 20 years. I just can’t justify the cost.
    The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.

    1.2 Coastal Carpet Pythons
    Mack The Knife, 2013
    Lizzy, 2010
    Etta, 2013
    1.1 Jungle Carpet Pythons
    Esmarelda , 2014
    Sundance, 2012
    2.0 Common BI Boas, Punch, 2005; Butch, age?
    0.1 Normal Ball Python, Elvira, 2001
    0.1 Olive (Aussie) Python, Olivia, 2017

    Please excuse the spelling in my posts. Auto-Correct is my worst enema.

  2. The Following User Says Thank You to Reinz For This Useful Post:

    BR8080 (04-18-2018)

  3. #22
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,603
    Thanks
    3,023
    Thanked 10,069 Times in 4,867 Posts
    Images: 34

    Re: Reptilinks!!!???

    Quote Originally Posted by DennisM View Post
    I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
    They work well for lizards that need a variety of whole prey and veggies in their diet, especially the ones that tend to pick out the foods they like and leave the rest.

    Also some snake owners's significant others don't care to look at a package of mice or rats in the freezer when they go digging for a package of ground beef.

  4. The Following User Says Thank You to bcr229 For This Useful Post:

    DennisM (04-17-2018)

  5. #23
    BPnet Veteran SDA's Avatar
    Join Date
    08-25-2017
    Location
    West Tennessee
    Posts
    1,559
    Thanks
    220
    Thanked 1,478 Times in 824 Posts
    I have heard second hand issues with these. Is there any documented cases of snakes having impaction or digestive problems with these? I take almost every second hand story as someone who has no idea what they are doing grasping at straws to blame why their snake died but I have read several complaints about these so I am curious. I know they are fabulous for lizards that tear and rip their prey apart but for snakes that swallow whole is what I am wondering about.
    1.0 ♂ 2010 Spider BP 'Dante'
    1.0 ♂ 2017 Bay of LA Rosy Boa 'Queso'
    0.0.1 2017 Aru GTP 'Ganja'
    1.0 ♂ Blue Tick Coonhound 'Blue'

    1.0 ♂ 2018 Basset Hound 'Cooper'

  6. #24
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by DennisM View Post
    I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
    I want to offer it simply for variety in my snakes' diets. It wouldnt be a staple. Since my little boas are too small to eat stuff like chicks, quails and rabbits, a link here and there i believe would be a good change.

    Quote Originally Posted by SDA View Post
    I have heard second hand issues with these. Is there any documented cases of snakes having impaction or digestive problems with these? I take almost every second hand story as someone who has no idea what they are doing grasping at straws to blame why their snake died but I have read several complaints about these so I am curious. I know they are fabulous for lizards that tear and rip their prey apart but for snakes that swallow whole is what I am wondering about.
    I couldnt imagine how a Reptilink would cause impaction. It's not wet sand or a giant piece of undigestible material. A snake's stomach digests bone, i think it digest a sausage casing. And not all lizards tear their prey unless it is too big. My Nile monitor used to just swallow mice and small rats lol. Big stuff he would hold them in his mouth and then use his claw to rip them open and then drag them around all proud. That made for a big mess. My Savannahs used to just swallow stuff too. My beardie also would just swallow the links.
    Last edited by Sauzo; 04-17-2018 at 04:30 PM.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  7. #25
    BPnet Veteran
    Join Date
    11-22-2016
    Location
    Rochester, NY
    Posts
    1,097
    Thanks
    919
    Thanked 586 Times in 368 Posts
    Images: 106

    Re: Reptilinks!!!???

    Quote Originally Posted by asplundii View Post
    I have been using ReptiLinks for about three years now. I feed them to my BHP, bredli, GTP, hognose, and occasionally my GBKs. And I just picked up a couple new species this weekend that I will also try these on once they settle in.

    All in all I like them. I have a variety of different types; frog, guinea fowl, quail, quail/frog, rabbit, iguana, megablend... Might have one or two others, cannot recall off the top of my head... For species that are not normally rodent feeders in the wild I feel these are a preferable food source as it more closely mimics what they would be eating. And gram for gram I feel they have better nutrition as well and so I have to feed less frequently.
    How do you thaw them and heat for feeding? You mention feeding less frequently based on nutritional value, could you please explain?

    Quote Originally Posted by John1982 View Post
    I've been using them for a couple years now to add variety for some of my snakes. Sometimes harder hitting animals will create a mess and sometimes the ends aren't tied off well so one side will be unravelled after thawing. Some of my harder hitting/chewing stuff can equally rip a f/t rodent in half so I'm used to cleaning after feeding anyway, haha. All in all, I like them for what they are and will continue using. Nothing I keep gets them as a staple but I've always got a few packages in the freezer so I can mix things up. Success varies but far less than half of my snakes turn down links. I do tend to offer them stuff they'd naturally be interested in in the wild though. I'm not tossing rabbit links at garter snakes, etc.

    How do you thaw them and heat for feeding?


    Quote Originally Posted by Sauzo View Post
    Not sure how big your BHPs are or what their equivalent in rat weight is but Caesar usually eats about 360ish gram rat. Rosey gets around a 275-300 gram rat and Vicky gets a 250 gram rat. I'll see though as i probably will put in a small order of 25 gram rabbit and quail and chicken ones for the little boas and some quail mini links for Pat. Might do a single order of the 100 gram rabbit and quail to see how big they are. Worst case, I'm sure Vicky can eat them.
    ​I remember reading somewhere and asked asplundii about the less frequent feeding based on nutritional value vs whole prey items.
    Ball Python
    0.1 Lesser (Lucille) local pet store
    Boas
    0.1 Caulkers Cay (CC) from TJ Blevins (Second City Constrictors)
    1.0 Sunglow het moonglow (Sonny) from Dustin Dirnberger
    1.0 BCI - DH Sharp Snow (Bob) from TJ Blevins (Second City Constrictors)
    1.0 Brazillian Rainbow Boa (Babylon) from Ike Lightener (Ike's Exotics & Aquatics)
    Pythons
    0.0.1 Unknown/undocumented rescue (Roger)
    1.0
    Northern White Lip (Solo)
    Cats

    1.1 Domestic short hair (Esther and James)
    Snake Wishlist
    Drymarchon Malanurus (Black Tail Cribno)
    SD/D Retic
    Woma or Black Headed Python
    Other Reptile Wishlist
    Poison dart frogs

  8. #26
    BPnet Royalty John1982's Avatar
    Join Date
    08-13-2010
    Location
    Florida
    Posts
    4,009
    Thanks
    2,496
    Thanked 2,962 Times in 1,669 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by DennisM View Post
    I'm curious why one would choose to feed these rather than whole prey animals. The cost per pound is 3-4 times that of frozen feeders purchased in bulk.
    Variety and convenience. I can buy rabbit/quail/frog/etc links, whole chicks, whole quail, quail eggs, whole rats, whole mice in 1 shipment/box. Their whole prey prices are pretty much on par with my other frozen feeder suppliers so about twice a year(when I'm low on links) I go ahead and make an order from them and restock all feeders plus several bags of links. I'm usually restocking other feeders every 2-3 months.

  9. The Following User Says Thank You to John1982 For This Useful Post:

    DennisM (04-18-2018)

  10. #27
    BPnet Royalty John1982's Avatar
    Join Date
    08-13-2010
    Location
    Florida
    Posts
    4,009
    Thanks
    2,496
    Thanked 2,962 Times in 1,669 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by BR8080 View Post

    How do you thaw them and heat for feeding?
    No different from thawing rodents. Use your preferred method.
    Last edited by John1982; 04-18-2018 at 06:21 AM.

  11. The Following User Says Thank You to John1982 For This Useful Post:

    BR8080 (04-23-2018)

  12. #28
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts
    When i fed them to my beardie, i would just toss them into a baggie and float them in warm water until thawed just like rodents.

    As for higher nutritional value, i might be an idiot but i dont see how they would be higher than whole prey. I see them as being equal since really the only difference you are doing is grinding up whole prey. Sure you skip the feathers in the case of birds but i dont see that as adding that much more. A 100 gram link would equal 100 grams of whole prey worth of food unless i am missing something.

    The main reason i want to try them is to just give variety to my smaller snakes.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  13. #29
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Reptilinks!!!???

    Quote Originally Posted by Sauzo View Post
    Not sure how big your BHPs are or what their equivalent in rat weight is but Caesar usually eats about 360ish gram rat. Rosey gets around a 275-300 gram rat and Vicky gets a 250 gram rat.
    My BHP is 2 meters long, about as big around as a soda can. I do not weigh my rats but she can down a medium and not have a noticeable bulge.


    Quote Originally Posted by DennisM View Post
    I'm curious why one would choose to feed these rather than whole prey animals.
    As I said above, these allow me to feed my animals a diet closer to what they would be eating in the wild which I feel is better for them. BHPs, bredli, GTPs, GBKs, hognose... None of these animals evolved eating European-domestic rodents and a captive diet composed of them is not exactly the best for them, this is part of the reason why we see such a problem with obesity and FLD in a lot of these species. And, these are whole prey so it is not a "rather than" situation.


    Quote Originally Posted by BR8080 View Post
    You mention feeding less frequently based on nutritional value, could you please explain?
    Quote Originally Posted by Sauzo View Post
    As for higher nutritional value, i might be an idiot but i dont see how they would be higher than whole prey. I see them as being equal since really the only difference you are doing is grinding up whole prey... A 100 gram link would equal 100 grams of whole prey worth of food unless i am missing something.
    Nick has done a few podcasts and discussed this in detail but in short -- If you look at a typical whole prey item, about 20-30% of that item is intestines full of predigested and fecal matter, they pull most of that out (basically from the bottom of the stomach down). By using links you gain back that 20-30% in "useful" material. Additionally, because the material in ReptiLinks is ground, it is digested more easily and the nutrients are absorbed better than versus whole prey. All of this together makes ReptiLinks more calorie dense than rodents so feeding the same gram weight is providing higher calories and you can feed less often.


    Quote Originally Posted by SDA View Post
    I have heard second hand issues with these. Is there any documented cases of snakes having impaction or digestive problems with these? I take almost every second hand story as someone who has no idea what they are doing grasping at straws to blame why their snake died but I have read several complaints about these so I am curious.
    I have never had any issues with impaction and I have not heard any first-hand accounts of this...


    Quote Originally Posted by BR8080 View Post
    How do you thaw them and heat for feeding?
    I take whatever I need to feed for the week out of the freezer, put it in a Ziplock bag and throw it in the bucket of hot water that I am using to thaw out my F/T rats in.


    Quote Originally Posted by cron14 View Post
    Not to railroad the thread but, has anyone tried the ASF scent to get a picky eater on f/t? I’ve always fed live but have been trying the last few months to make the switch for convienence. Hes still healthy and I’m fine to feed live if this goes on much longer but wanted to know if anyone has had some success. I’d say the last time I offered f/t he showed the most interest so I feel like I’m close.
    I have all their scents, mostly for some obscure species I am working with to help me get things feeding, have not used the fish one yet but the frog, lizard, and gecko ones have proven useful for me. I have used the ASF scent on a rat a couple times for a ball that I picked up and was told was eating rats only to find out it was on ASFs. It seems to spark a bit of interest but he has only taken 1 of the 4 rats I have done this with so jury is still out.
    Last edited by asplundii; 04-18-2018 at 09:04 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following User Says Thank You to asplundii For This Useful Post:

    BR8080 (04-23-2018)

  15. #30
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,603
    Thanks
    3,023
    Thanked 10,069 Times in 4,867 Posts
    Images: 34

    Re: Reptilinks!!!???

    Quote Originally Posted by asplundii View Post
    I have used the ASF scent on a rat a couple times for a ball that I picked up and was told was eating rats only to find out it was on ASFs. It seems to spark a bit of interest but he has only taken 1 of the 4 rats I have done this with so jury is still out.
    Live or f/t rats?

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1