Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 719

1 members and 718 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,904
Threads: 249,099
Posts: 2,572,074
Top Poster: JLC (31,651)
Welcome to our newest member, GeneticArtist
Results 1 to 10 of 31

Threaded View

  1. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have been using ReptiLinks for about three years now. I feed them to my BHP, bredli, GTP, hognose, and occasionally my GBKs. And I just picked up a couple new species this weekend that I will also try these on once they settle in.

    All in all I like them. I have a variety of different types; frog, guinea fowl, quail, quail/frog, rabbit, iguana, megablend... Might have one or two others, cannot recall off the top of my head... For species that are not normally rodent feeders in the wild I feel these are a preferable food source as it more closely mimics what they would be eating. And gram for gram I feel they have better nutrition as well and so I have to feed less frequently.

    Some animals can be difficult to get feeding, I have this problem with my GBKs actually as they seem to imprint harder than balls on a food item, but for those that are enthusiastic eaters or are not finicky you should have no problems. And I have had some balls that will take these as well, though I do not feed them links on the regular (and again, it is the ones that have such a strong feed response that they would literally eat a rat that was still frozen).

    If you have easy access to them then I would suggest at least trying them on some of your animals for a while and seeing how they work for you.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    BR8080 (04-18-2018),Sauzo (04-16-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1