Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,111

1 members and 1,110 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,146
Posts: 2,572,379
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 14

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Human Chimerism...

    Quote Originally Posted by cchardwick View Post
    I imagine it's impossible to breed this snake if it is indeed true chimerism, the DNA would be all messed up or if it does breed you would get one or the other genetic material, it's not possible to reproduce this in the offspring.
    It is completely possible for chimeras to breed. Nick Mutton has a chimeric carpet and it produced a perfectly fine clutch, all of which hatched out.


    Quote Originally Posted by Godzilla78 View Post
    It seems you missed the part in the article that said her auto-immune disease is caused by her having 2 sets of DNA and 2 immune systems, so it is inherent in being a chimera to have this problem.
    False correlation. Just because this one woman, who is a chimera, developed an auto-immune disease does not mean that all chimeras will necessarily develop auto-immune disease. It is not an inherent condition of chimerism.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Godzilla78 (03-05-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1