Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,725

0 members and 1,725 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,086
Threads: 249,227
Posts: 2,572,841
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
Page 1 of 2 12 LastLast
Results 1 to 10 of 14
  1. #1
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16

    Human Chimerism...

    I found this article really interesting, we often discuss what is a 'Chimera' and what affect it has on the ball python in question. Here's an example of human chimerism and this article explains how it affects her health and explains exactly what it is. I find it interesting that she has a split color through the length of her body, similar to some of the chimera ball pythons I've seen. Here's the article:

    https://www.womenshealthmag.com/heal...259/chimerism/

    It makes me wonder if a chimera ball python is always in pain as well?

    Here's what we think is a possible chimera in ball pythons. I imagine it's impossible to breed this snake if it is indeed true chimerism, the DNA would be all messed up or if it does breed you would get one or the other genetic material, it's not possible to reproduce this in the offspring.



    Last edited by cchardwick; 03-04-2018 at 09:30 AM.


  2. The Following 3 Users Say Thank You to cchardwick For This Useful Post:

    MD_Pythons (03-04-2018),Reinz (03-04-2018),tttaylorrr (03-04-2018)

  3. #2
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: Human Chimerism...

    here's another fascinating sorry about a woman who found out the children she gave birth to were genetically not her offspring, and the harrowing legal battle her family had to go through: http://abcnews.go.com/Primetime/shes...ory?id=2315693

    i've never heard of the woman you posted, but my god she is beautiful!!! i'm so glad she's found a platform to talk about herself. that's awesome! i can only imagine what she deals with on a daily basis...a good friend had endometriosis; she had to have a hysterectomy at 16. ):

    TBH, when it comes to Skittles, i'd like to think she has the best veterinary care available, and if she was in pain it would be known. also, the Skittles line has produced many other chimera babies (according to the breeder) so it will be interesting to learn more about Skittles if we ever can.
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  4. #3
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts
    That is whack, I had no idea what Chimerism was, and even more astounded that even some humans have this rare condition.

    Thanks for the link

  5. #4
    BPnet Lifer Reinz's Avatar
    Join Date
    08-05-2013
    Location
    East TX
    Posts
    8,019
    Thanks
    5,613
    Thanked 4,602 Times in 3,139 Posts
    Images: 9
    Very interesting CC, thanks!
    The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.

    1.2 Coastal Carpet Pythons
    Mack The Knife, 2013
    Lizzy, 2010
    Etta, 2013
    1.1 Jungle Carpet Pythons
    Esmarelda , 2014
    Sundance, 2012
    2.0 Common BI Boas, Punch, 2005; Butch, age?
    0.1 Normal Ball Python, Elvira, 2001
    0.1 Olive (Aussie) Python, Olivia, 2017

    Please excuse the spelling in my posts. Auto-Correct is my worst enema.

  6. #5
    Registered User
    Join Date
    10-12-2017
    Posts
    17
    Thanks
    15
    Thanked 12 Times in 10 Posts
    While I feel very sorry for the woman in the article, it seems that her issue is the autoimmune disease that she has, not being a chimera. In general most people who are chimeras don't even know unless there is something like DNA testing for child support that comes up in their life. Even that might not catch it depending on the patterning of their cells v. where the DNA sample is taken from.

    Interestingly, chimerism does seem to have a genetic basis, and there's a pretty amusing article written about how it is actually very common in marmosets. For marmosets it's an evolutionary adaptation in order to motivate more adults to care for each offspring. Since snakes don't typically care for offspring, and especially not male snakes, chimerism probably isn't something that has been selected for in the wild. However, I'd guess that it would theoretically be possible to breed and artificially select for chimeras in order to create lines that were more prone to it.

  7. The Following 2 Users Say Thank You to fieldfare For This Useful Post:

    Godzilla78 (03-04-2018),MD_Pythons (03-04-2018)

  8. #6
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: Human Chimerism...

    Quote Originally Posted by fieldfare View Post
    While I feel very sorry for the woman in the article, it seems that her issue is the autoimmune disease that she has, not being a chimera. In general most people who are chimeras don't even know unless there is something like DNA testing for child support that comes up in their life. Even that might not catch it depending on the patterning of their cells v. where the DNA sample is taken from.

    Interestingly, chimerism does seem to have a genetic basis, and there's a pretty amusing article written about how it is actually very common in marmosets. For marmosets it's an evolutionary adaptation in order to motivate more adults to care for each offspring. Since snakes don't typically care for offspring, and especially not male snakes, chimerism probably isn't something that has been selected for in the wild. However, I'd guess that it would theoretically be possible to breed and artificially select for chimeras in order to create lines that were more prone to it.
    It seems you missed the part in the article that said her auto-immune disease is caused by her having 2 sets of DNA and 2 immune systems, so it is inherent in being a chimera to have this problem.


    Sent from my iPhone using Tapatalk

  9. The Following User Says Thank You to Godzilla78 For This Useful Post:

    Team Slytherin (03-04-2018)

  10. #7
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: Human Chimerism...

    In the marmoset article, the definition seems different. The first woman completely absorbed her fraternal twin’s DNA.


    Sent from my iPhone using Tapatalk

  11. #8
    Registered User
    Join Date
    10-12-2017
    Posts
    17
    Thanks
    15
    Thanked 12 Times in 10 Posts

    Re: Human Chimerism...

    The first article seemed a bit sensationalized (although it was still interesting) but it's actually the same thing happening in both. Chimeras are made up of cells that are genetically different, unlike most of us who have a single (mostly) consistent set of DNA throughout all of our cells. They still only have one set of DNA per cell. The lady in the first article's embryo fused early in development with what would have been her twin, but then developed normally aside from that, so some of her cells have one set of DNA and others have the other set of DNA. In marmosets, they just switch some cells while developing instead of fusing into one organism, but the end result is the same, just with both twins being born.

    As for the auto immune issues, it makes sense that it could be a problem for chimeras but my point was that it is something that doesn't generally seem to be an major issue for them. The first article was kind of confusing with a lot of their terminology, especially the whole "two bloodstreams" part. If she has two different blood types then I am absolutely not surprised that she is having auto immune issues. Basically yeah it is something that could be a concern but I felt like it was over hyped and not very well explained.

  12. The Following 2 Users Say Thank You to fieldfare For This Useful Post:

    Godzilla78 (03-04-2018),Timelugia (03-04-2018)

  13. #9
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Human Chimerism...

    A typical chimera starts as two fertilized egg cells. For birds and egg-laying snakes, the chimera must hatch from a double-yolked egg. I had a bullsnake that in three clutches dropped 1-3 eggs per clutch twice the size of the other eggs. These large eggs were probably double yolked. (I did not open them to see.) Such eggs hatched out one large but otherwise normal looking baby. And a Burmese python breeder buddy of mine often had one or two eggs in a clutch that contained twins. So double yolk eggs are not terribly uncommon.

    Double yolk eggs also occur in chickens, too. http://www.abc.net.au/radionational/...lk-egg/7625330
    Last edited by paulh; 03-04-2018 at 11:11 PM.

  14. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Human Chimerism...

    Quote Originally Posted by cchardwick View Post
    I imagine it's impossible to breed this snake if it is indeed true chimerism, the DNA would be all messed up or if it does breed you would get one or the other genetic material, it's not possible to reproduce this in the offspring.
    It is completely possible for chimeras to breed. Nick Mutton has a chimeric carpet and it produced a perfectly fine clutch, all of which hatched out.


    Quote Originally Posted by Godzilla78 View Post
    It seems you missed the part in the article that said her auto-immune disease is caused by her having 2 sets of DNA and 2 immune systems, so it is inherent in being a chimera to have this problem.
    False correlation. Just because this one woman, who is a chimera, developed an auto-immune disease does not mean that all chimeras will necessarily develop auto-immune disease. It is not an inherent condition of chimerism.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  15. The Following User Says Thank You to asplundii For This Useful Post:

    Godzilla78 (03-05-2018)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1