» Site Navigation
0 members and 612 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Candy ball pythons
I'm wondering how long do candy ball pythons hold their lavender and orange. From the few photos I've seen they turn a tan and like a light brown as adults, almost like adult ultramels does this happen within a few years or does it take longer?
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
-
Most Candy will attain their full colour by 12-18 months or so, though I have a friend who said one of his changed slowly until about 24 months
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Candy ball pythons
 Originally Posted by asplundii
Most Candy will attain their full colour by 12-18 months or so, though I have a friend who said one of his changed slowly until about 24 months
I find it so strange how many BP morphs end up looking the same. If the photos I've seen are to be believed candy, toffee and ultramel all are very similar as adults. Kind of a shame when you think of how they start out as juveniles.
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
The Following User Says Thank You to OTorresUSMC For This Useful Post:
-
Re: Candy ball pythons
 Originally Posted by OTorresUSMC
I find it so strange how many BP morphs end up looking the same. If the photos I've seen are to be believed candy, toffee and ultramel all are very similar as adults. Kind of a shame when you think of how they start out as juveniles.
Well Candy and Toffee are the exact same mutation so it is no surprise that they look alike 
As far as Ultramel... They are a fair bit darker as adults that Candy/Toffee.
If you like the lighter look of young Candy/Toffee then I would suggest picking up a CandIno or ToffIno, they stay really nice into adulthood
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Candy ball pythons
 Originally Posted by asplundii
Well Candy and Toffee are the exact same mutation so it is no surprise that they look alike
As far as Ultramel... They are a fair bit darker as adults that Candy/Toffee.
If you like the lighter look of young Candy/Toffee then I would suggest picking up a CandIno or ToffIno, they stay really nice into adulthood
Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
The Following User Says Thank You to OTorresUSMC For This Useful Post:
-
Re: Candy ball pythons
 Originally Posted by OTorresUSMC
Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
I don’t know much about morphs either. So many look alike to me, as well. But Semper Fi brother!
Sent from my iPhone using Tapatalk
Ball Pythons
0.1 Spinner -“Cuddle Bug”
0.1 Banana YB - “Chiquita Bonita”
0.1 Super Lesser BEL - “Daenerys - Mother of Dragons”
1.0 Pastel Highway - “Lt. Pete ‘Maverick’ Mitchell
1.0 Super Citrus Bearded Dragon hopefully shipping mid-March, name pending.
-
The Following User Says Thank You to Sgt7212 For This Useful Post:
-
Re: Candy ball pythons
 Originally Posted by OTorresUSMC
Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
Nice. Enjoy your ultramel! They are pretty! Post pictures if/when you can.
I hear you on the many morphs; it's hard to have just one! Not sure I envy breeders though, that sounds like a lot of work, and poop, lot's of poop too!
Seriously, enjoy your new addition.
Thank you for your service!
First male in my family in 3 generations not to serve (kidney problems - not proud of it). My grandfather in the army in WWII, my father and uncle in Vietnam (army and navy), my two cousins (Navy officer and Marine F-18 pilot).
I know the sacrifices you make for the rest of us; sincerely, thank you (you too Sgt7212).
Last edited by dakski; 02-28-2018 at 04:31 AM.
-
The Following 2 Users Say Thank You to dakski For This Useful Post:
OTorresUSMC (02-28-2018),Sgt7212 (02-28-2018)
-
Re: Candy ball pythons
Appreciate the kind words dakski. And Semper Fi Sgt7212!! My ultramel girl is in shed right now but I'll get some pics up as soon as she's out. Many plans for her once she makes weight. May actually need to pick up an ultra male since I have a couple different genes I want to work in.
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
The Following User Says Thank You to OTorresUSMC For This Useful Post:
-
Re: Candy ball pythons
Having a small collection is pretty time consuming as well, ehhh 20 animals in total but 6 BPs and my Boa still take time lol I’m wicked ocd with my husbandry and it drives me bonkers when they bulldoze everything lol
3rd Battalion 7th Marines 2nd Brigade Combat Team, 1st Marine Expeditionary Force
OIF 04-06 Ar Ramadi, Iraq
OORAHH! Get some devils!
Sent from my iPhone using Tapatalk
-
The Following 3 Users Say Thank You to Aerries For This Useful Post:
dakski (02-28-2018),Sgt7212 (02-28-2018),Virago (02-28-2018)
-
Re: Candy ball pythons
 Originally Posted by Aerries
Having a small collection is pretty time consuming as well, ehhh 20 animals in total but 6 BPs and my Boa still take time lol I’m wicked ocd with my husbandry and it drives me bonkers when they bulldoze everything lol
3rd Battalion 7th Marines 2nd Brigade Combat Team, 1st Marine Expeditionary Force
OIF 04-06 Ar Ramadi, Iraq
OORAHH! Get some devils!
Sent from my iPhone using Tapatalk
Semper Fi brother! Looks like the Marines have landed on BP.net 🦅 ⚓️ 
Sent from my iPad using Tapatalk
Ball Pythons
0.1 Spinner -“Cuddle Bug”
0.1 Banana YB - “Chiquita Bonita”
0.1 Super Lesser BEL - “Daenerys - Mother of Dragons”
1.0 Pastel Highway - “Lt. Pete ‘Maverick’ Mitchell
1.0 Super Citrus Bearded Dragon hopefully shipping mid-March, name pending.
-
The Following 3 Users Say Thank You to Sgt7212 For This Useful Post:
dakski (02-28-2018),OTorresUSMC (02-28-2018),Virago (02-28-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|