Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 881

1 members and 880 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,229
Posts: 2,572,847
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Results 1 to 10 of 15

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    I find it so strange how many BP morphs end up looking the same. If the photos I've seen are to be believed candy, toffee and ultramel all are very similar as adults. Kind of a shame when you think of how they start out as juveniles.
    Well Candy and Toffee are the exact same mutation so it is no surprise that they look alike

    As far as Ultramel... They are a fair bit darker as adults that Candy/Toffee.

    If you like the lighter look of young Candy/Toffee then I would suggest picking up a CandIno or ToffIno, they stay really nice into adulthood
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    OTorresUSMC (02-27-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1