Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 575

0 members and 575 guests
No Members online
Most users ever online was 47,180, Yesterday at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,899
Threads: 249,095
Posts: 2,572,066
Top Poster: JLC (31,651)
Welcome to our newest member, HellboyBoa
Page 1 of 2 12 LastLast
Results 1 to 10 of 12

Thread: What morph?

  1. #1
    Registered User
    Join Date
    02-26-2018
    Posts
    4
    Thanks
    7
    Thanked 1 Time in 1 Post

    What morph?

    Hello I recently got my first snake. Purchased it at pet smart. It was listed as “fancy python” any idea of the exact type of snake it is? Thanks a lot. Sorry if I posted in the wrong place.


    Sent from my iPhone using Tapatalk

  2. #2
    Registered User C.Marie's Avatar
    Join Date
    05-14-2017
    Posts
    1,465
    Thanks
    4,683
    Thanked 703 Times in 603 Posts
    Horrible at morphs fire pastel maybe, I am sure someone better will steer you right, congratulations what a cutie pie
    Domestic Short Hair - Miss Becky
    Russian Blue - Church
    Miniature Poodle - Pierre LaPoodlePants
    Banana BP - Yuri Katsuki

  3. The Following User Says Thank You to C.Marie For This Useful Post:

    jayywood (03-01-2018)

  4. #3
    BPnet Veteran Tonald Drump's Avatar
    Join Date
    10-23-2017
    Posts
    364
    Thanks
    97
    Thanked 128 Times in 84 Posts

    Re: What morph?

    Not good on morphs, but to me you sound confused about the type too. It's a Ball Python (Python regius).

    Sent from my vivo 1601 using Tapatalk

  5. The Following User Says Thank You to Tonald Drump For This Useful Post:

    jayywood (03-01-2018)

  6. #4
    BPnet Veteran BluuWolf's Avatar
    Join Date
    07-08-2017
    Posts
    564
    Thanks
    143
    Thanked 395 Times in 276 Posts

    Re: What morph?

    That’s a Ball Python and as for the morph I would say Pastel. Pastel gives it that yellow coloring and the yellow line patterning across the eyes is an indicator of pastel. If it’s eyes are green that’s an indicator of pastel as well

    Just some friendly advice though, I would recommend ditching that log hide he is on for a hide that only has one opening. Those are not very secure and will him him feel exposed.

    Hope this helps!


    Sent from my iPhone using Tapatalk

  7. The Following User Says Thank You to BluuWolf For This Useful Post:

    jayywood (03-01-2018)

  8. #5
    BPnet Veteran djansen's Avatar
    Join Date
    02-06-2007
    Location
    Tempe AZ
    Posts
    1,211
    Thanks
    76
    Thanked 146 Times in 118 Posts
    Images: 1

    Re: What morph?

    Quote Originally Posted by BluuWolf View Post
    Just some friendly advice though, I would recommend ditching that log hide he is on for a hide that only has one opening. Those are not very secure and will him him feel exposed.


    Sent from my iPhone using Tapatalk
    just cover the one end in substrate and good to go.
    I'm not your friend buddy!

  9. The Following User Says Thank You to djansen For This Useful Post:

    jayywood (03-01-2018)

  10. #6
    BPnet Veteran BluuWolf's Avatar
    Join Date
    07-08-2017
    Posts
    564
    Thanks
    143
    Thanked 395 Times in 276 Posts

    Re: What morph?

    Quote Originally Posted by djansen View Post
    just cover the one end in substrate and good to go.
    Yeah there was another thread I saw where they had kind of buried the back half and made it almost like a cave. It looked pretty cool too lol


    Sent from my iPhone using Tapatalk

  11. The Following User Says Thank You to BluuWolf For This Useful Post:

    jayywood (03-01-2018)

  12. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Definitely Pastel... Given some of the pattern disruption and the blushing I am half inclined to say Pastel Yellowbelly, but I would want belly pics to confirm.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following User Says Thank You to asplundii For This Useful Post:

    jayywood (03-01-2018)

  14. #8
    BPnet Veteran Phillydubs's Avatar
    Join Date
    02-04-2018
    Posts
    1,285
    Thanks
    510
    Thanked 1,244 Times in 667 Posts
    Mind me asking what a speciment like that goes for at a place like that?

  15. #9
    Registered User Sgt7212's Avatar
    Join Date
    02-21-2018
    Location
    NJ
    Posts
    214
    Thanks
    306
    Thanked 186 Times in 111 Posts

    What morph?

    Quote Originally Posted by Phillydubs View Post
    Mind me asking what a speciment like that goes for at a place like that?
    I’m not sure about PetSmart, but at Petco, “fancy” ball pythons are $149. The Spinner I got was in the fancy tank, along with a pinstripe. They also have a category called “rare,” which run $249. Ball pythons I’ve seen in those tanks include Banana, Albino and Genetic Stripe. They sell normals for $69, but I’ve always seen additional signage on the normal tank that says “normal ball pythons 50% off with Pals Rewards” If you’re in the Philly area,there are 2 stores with good selections. My full time gig is in Horsham, and the Willow Grove store is where I got my Spinner. I also work a 2nd job at a Harley dealer North of Philly, so I’ve checked out the Petco stores Feasterville and Bensalem also. They only have normals and said they don’t get much call for snakes. The best selection was the Petco on Roosevelt Blvd. One of the managers there said their GM breeds BP’s and loves snakes. The other night they had 2 Albinos, 2 Genetic Stripes, 1 Banana, 1 Pinstripe and she said they were getting more in on Wednesday, Feb 28th.

    I hope that helps.


    Sent from my iPhone using Tapatalk
    Last edited by Sgt7212; 02-28-2018 at 02:35 AM.
    Ball Pythons
    0.1 Spinner -“Cuddle Bug”
    0.1 Banana YB - “Chiquita Bonita”
    0.1 Super Lesser BEL - “Daenerys - Mother of Dragons”
    1.0 Pastel Highway - “Lt. Pete ‘Maverick’ Mitchell

    1.0 Super Citrus Bearded Dragon hopefully shipping mid-March, name pending.

  16. The Following User Says Thank You to Sgt7212 For This Useful Post:

    jayywood (03-01-2018)

  17. #10
    Registered User
    Join Date
    02-26-2018
    Posts
    4
    Thanks
    7
    Thanked 1 Time in 1 Post

    Re: What morph?

    Quote Originally Posted by BluuWolf View Post
    That’s a Ball Python and as for the morph I would say Pastel. Pastel gives it that yellow coloring and the yellow line patterning across the eyes is an indicator of pastel. If it’s eyes are green that’s an indicator of pastel as well

    Just some friendly advice though, I would recommend ditching that log hide he is on for a hide that only has one opening. Those are not very secure and will him him feel exposed.

    Hope this helps!


    Sent from my iPhone using Tapatalk
    Yes I have seen some people close the end of the log with substrate I will do that! Thanks.


    Sent from my iPhone using Tapatalk

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1