Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 903

2 members and 901 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 2 FirstFirst 12
Results 11 to 15 of 15
  1. #11
    BPnet Royalty dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    4,931
    Thanks
    8,330
    Thanked 10,043 Times in 3,987 Posts
    Images: 134

    Re: what eats Discoid roaches (Blaberus discoidalis)?

    Quote Originally Posted by artgecko View Post
    My gargoyle and crested geckos will eat dubia, although not all of them will. My blue tongue skink will mow them down. My remaining fancy rat will also eat them. Bearded dragons will eat a lot of them too. Tarantulas will also eat them, although I don't have experience keeping those. Probably large mantids would as well.
    I'll have to try feeding Frank, my BTS, roaches again. Good to know yours loves them. Thank you!

  2. #12
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: what eats Discoid roaches (Blaberus discoidalis)?

    Quote Originally Posted by Deborah View Post
    Crested geckos and Chahoua will eat insect but this is not their main diet they mainly eat fruits in the form of Pangea Complete diet (So bug is only in addition to their diet), you can also get Gargoyles to eat roaches but there is a trick because Gary's are lazy and do not like to chase (basically you contain the roaches in a 4 inch ceramic bowl so they don't have to chase)

    I have 2 pet geckos now (No longer breeding Crested) a Garg and a Chaouha and between the 2 of them they get 12 roaches a week, nothing that makes a big dent in a large colony.

    Now Leo eat bugs as their staple diet.

    As far as selling I know most people sell on EBay but I am sure they do on CL too, just not sure you would want to meet a stranger for $10 or less, I know I would not.
    thank you for all the info, Deborah!!!

    - - - Updated - - -

    Quote Originally Posted by artgecko View Post
    Probably large mantids would as well.
    mantids!!! excellent idea!
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  3. #13
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts

    Re: what eats Discoid roaches (Blaberus discoidalis)?

    Quote Originally Posted by dakski View Post
    I'll have to try feeding Frank, my BTS, roaches again. Good to know yours loves them. Thank you!
    Yeah, my guy gets them as a treat only (I think he likes them more than his regular dog food / vegg mix). I feed him off tongs with them and he has a horrible habit of biting, then letting the roach go, who then runs away with him chasing it. My worst fear is him ingesting too much substrate while trying to get the roach as it runs away lol.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  4. The Following User Says Thank You to artgecko For This Useful Post:

    dakski (02-22-2018)

  5. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Something that has not been brought up as roach eaters is other arthropods like tarantulas/scorpions/centipedes. I basically maintain a dubia colony for my daughter's AFT and the genic I inherited during my divorce.

    Another option would be frogs/toads. I had a colony of waxy tree frogs for a while and they loved roaches. I imagine a White's would be large enough to eat discoids... A horned frog would eat them too...

    You could always just raise them for no reason as well. I have a whole colony of Eublaberus sp. Ivory that I keep just because they are kinda cool
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #15
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts

    Re: what eats Discoid roaches (Blaberus discoidalis)?

    Quote Originally Posted by asplundii View Post
    Something that has not been brought up as roach eaters is other arthropods like tarantulas/scorpions/centipedes. I basically maintain a dubia colony for my daughter's AFT and the genic I inherited during my divorce.

    Another option would be frogs/toads. I had a colony of waxy tree frogs for a while and they loved roaches. I imagine a White's would be large enough to eat discoids... A horned frog would eat them too...

    You could always just raise them for no reason as well. I have a whole colony of Eublaberus sp. Ivory that I keep just because they are kinda cool
    I forgot to mention frogs... yeah I got some whites ( a group of 5) and a couple pacman frogs once my colony was rolling. The whites can eat the small and medium juvie roaches, but not adults. The pacman frogs can eat the adults and large juvies but one of my pacman frogs has decided to not like them lol.

    Also, forgot to mention my chameleon. Be aware though, they are high maintenance and need more than just roaches, so I wouldn't consider them a good option unless you already wanted a chameleon and are willing to supplement with other types of feeders.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1