Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,376

1 members and 1,375 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,129
Posts: 2,572,290
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 17

Threaded View

  1. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by CALM Pythons View Post
    Just to let you know I now see it. I needed a better whiter light. Its much smaller that the OP's but definitely there.
    Yeah, the size can vary but it will always be there in some form or other.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    CALM Pythons (02-14-2018),jay127 (02-14-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1