Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 649

2 members and 647 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,129
Posts: 2,572,288
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 17

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by CALM Pythons View Post
    I think his is the same just his is more pronounced. Ive never had that in any of mine as i said.. And I certainly don't remember that being in albinos 20 years ago. here is his pic.
    Quote Originally Posted by CALM Pythons View Post
    I have a 2017 Albino so it just must be a certain Gene. I don't really look at all different genes of snakes and not many people have any around me..

    It is not a the result of some other gene, all Albinos have this trait because all ball pythons have it. When Bob used to have the pics of the original Albino on his site you could see it in the pics of that animal.

    If you look at the eye of any ball you will see that the top half is always a shade or two or three (or more) lighter than the bottom half because there is a pigment differential where the eye stripe passes through it. It is a bit more marked in Albinos because of the sharp contrast of their red eyes.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    CALM Pythons (02-08-2018),jay127 (02-09-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1