Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 680

1 members and 679 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 7 of 7

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The general consensus is that Acid, Static, and Confusion are likely allelic. From everything I have seen Acid seems to be the cleaner/better/stronger allele - sort of a BlkPastel versus Cinny comparison. Comparing Fred's Acid Pastel Spotnose to Josh's Riddler, Josh's animal has a more extreme, pronounced pattern overall where as Fred's is only really pronounced on the posterior portion. The Riddler is also brighter looking. The same holds true for the LemonDrop, Reflux, SuperPastel Acid...
    Last edited by asplundii; 02-08-2018 at 09:14 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (02-08-2018),JoeNapoli (08-30-2021),OTorresUSMC (02-08-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1