» Site Navigation
0 members and 645 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Acid/Static same or different
So Kicks Balls recently posted for sale a static pastel spotnose and it looks very very similar to Josh Jensens Riddler which is acid pastel spotnose. Particularly when you look at the head pattern. So I'm curious are these two lines of the same gene? They are both very new and just now becoming available to us normal people for sale, tho be it at steep prices. Just wondering if anyone else noticed this and had the same thoughts.
Last edited by OTorresUSMC; 02-07-2018 at 10:09 AM.
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
-
i think they are the same and have heard many peeps discuss the similarities and say the same thing. Static has been around longer tho, since 2008. Whereas J-Royals proved their Acid in 2014.
now there is a local breeder to me, Doug Day of HDI Reptiles, who has a similar gene called the Rogue. i first saw it in 2015 but he had been working w/ it already. it seems they've all paired their own liens w/ different genes to produce different combo's.
here are the first Rogues i saw. notice that they weren't for sale.


here they are at another show:

and some of their bellies. i forget which is the normal Rogue (i'm assuming the 2nd one):


as far as i know, no breeder has produced a Super Static, Super Acid or Super Rogue... yet.
anyway all very cool animals. i hope to get my hands on one someday.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Re: Acid/Static same or different
 Originally Posted by Ax01
i think they are the same and have heard many peeps discuss the similarities and say the same thing. Static has been around longer tho, since 2008. Whereas J-Royals proved their Acid in 2014.
now there is a local breeder to me, Doug Day of HDI Reptiles, who has a similar gene called the Rogue. i first saw it in 2015 but he had been working w/ it already. it seems they've all paired their own liens w/ different genes to produce different combo's.
here are the first Rogues i saw. notice that they weren't for sale.
here they are at another show:
and some of their bellies. i forget which is the normal Rogue (i'm assuming the 2nd one):
as far as i know, no breeder has produced a Super Static, Super Acid or Super Rogue... yet.
anyway all very cool animals. i hope to get my hands on one someday. 
If static has been around since '08 How is it still getting the hefty price tag?
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
-
Re: Acid/Static same or different
 Originally Posted by OTorresUSMC
If static has been around since '08 How is it still getting the hefty price tag?
i can't say for sure, u have to ask Fred Kick about that. but anyway i don't think they were available to the public until recently. Static, Acid and Rogue just hit the market in the last year and i assume they were priced to compete w/ each other thats all.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
The general consensus is that Acid, Static, and Confusion are likely allelic. From everything I have seen Acid seems to be the cleaner/better/stronger allele - sort of a BlkPastel versus Cinny comparison. Comparing Fred's Acid Pastel Spotnose to Josh's Riddler, Josh's animal has a more extreme, pronounced pattern overall where as Fred's is only really pronounced on the posterior portion. The Riddler is also brighter looking. The same holds true for the LemonDrop, Reflux, SuperPastel Acid...
Last edited by asplundii; 02-08-2018 at 09:14 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Ax01 (02-08-2018),JoeNapoli (08-30-2021),OTorresUSMC (02-08-2018)
-
Re: Acid/Static same or different
 Originally Posted by asplundii
The general consensus is that Acid, Static, and Confusion are likely allelic. From everything I have seen Acid seems to be the cleaner/better/stronger allele - sort of a BlkPastel versus Cinny comparison. Comparing Fred's Acid Pastel Spotnose to Josh's Riddler, Josh's animal has a more extreme, pronounced pattern overall where as Fred's is only really pronounced on the posterior portion. The Riddler is also brighter looking. The same holds true for the LemonDrop, Reflux, SuperPastel Acid...
I have to agree with you acid looks like the higher quality version of the gene. Seems to make better looking combos. I just can def see the similarities. Talked to Josh and yea it would seem acid static and confusion tho I have not heard of or seen confusion yet. Sadly I don't have the disposable income for any of them at this point anyway lol but acid is one I would like to add to my collection at some point.
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
-
Re: Acid/Static same or different
 Originally Posted by OTorresUSMC
I have to agree with you acid looks like the higher quality version of the gene. Seems to make better looking combos. I just can def see the similarities. Talked to Josh and yea it would seem acid static and confusion tho I have not heard of or seen confusion yet. Sadly I don't have the disposable income for any of them at this point anyway lol but acid is one I would like to add to my collection at some point.
Confusion seemed like it was mostly in Europe but I guess there was/is a source here in the US because a lot of breeders suddenly turned up with them this year (Ozzy, Kobylka, Wagner I think... Couple others...)
Acid is definitely a versatile gene and I think we will see some more fun stuff from it in a coming years.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|