Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,515

0 members and 1,515 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Page 2 of 2 FirstFirst 12
Results 11 to 18 of 18
  1. #11
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1

    Re: Is a strong feeding response genetic and can it be line bred for?

    Quote Originally Posted by enginee837 View Post
    I understand husbandry can be to blame for feeding issues however when all of my bp's are in a rack systsm that gives them exactly the same enviroment that factor gets ruled out. I have one female that for the last few years has eaten what ever I put in front of her, one female that eats f/t rats but eats sporadically and a male up until last year would eat f/t but went on a 8 month hunger strike and now will only take live. If he was not the most expensive bp in our collection I probbably would have fed him off to one of my aspedities as we have no interest in live feeding (too costly to purchase them and too much hassle to breed your own).
    Of our six hatchlings 4 ate almost immediately and have been pounding f/t rat pinks since day one, 2 required assist feeding before finally taking live mouse hoppers (they still refuse to switch). Again, all babies have exactly the same enviroment.
    So the real problems are not the snakes it's the fact that they don't want to eat what YOU want to feed them, that's very different.It's about feeding what works, in my experience even animals that are assisted can and will become the strongest feeders again if you feed what THEY want.

    I mean sure you can feed off a BP because he won't eat what YOU want it to eat but that got to be one of the worse justification, you might want to seriously revisit breeding BP unless you are willing to change your view on feeding what they want and not what YOU want because BP are unlike any other species and they won't always feed the way you want them too.
    Last edited by Stewart_Reptiles; 02-06-2018 at 08:06 PM.
    Deborah Stewart


  2. #12
    BPnet Veteran enginee837's Avatar
    Join Date
    06-14-2015
    Posts
    557
    Thanks
    134
    Thanked 604 Times in 278 Posts
    Images: 42

    Re: Is a strong feeding response genetic and can it be line bred for?

    Quote Originally Posted by Deborah View Post
    So the real problems are not the snakes it's the fact that they don't want to eat what YOU want to feed them, that's very different.It's about to feed what works, and even animals that are assisted in my experience become the strongest feeders again if you feed what they want, I mean sure you can feed off a BP because he won't eat what YOU want it to eat because you are not willing to make the effort but if it's the case, you might want to seriously revisit breeding BP unless you are willing to change your view on feeding what they want and not what YOU want.
    You are certainly entitled to your opinion however there are plenty of bp's that are more than happy to eat what I want to feed them. Hence the topic, is it possible to breed for this trait.
    1.0 Albino Black Pastel Pinstripe BP "Menolo"
    0.1 Albino Spider BP "Ginger"
    0.1 Black Pastel Het. Albino "Jasmine"

    1.0 Woma python "Stitch"
    0.1 Woma python "Milo"
    0.1 Woma python "Millie"

    1.0 Blackhead Python
    0.1 Blackhead Python
    0.1 Blackhead Python

    1.0 Black South African Boerboel "Midas"
    0.1 Chocolate Lab "Coco"

  3. #13
    BPnet Veteran enginee837's Avatar
    Join Date
    06-14-2015
    Posts
    557
    Thanks
    134
    Thanked 604 Times in 278 Posts
    Images: 42
    Oh and by the way, there are places where feeding live is illegal. What do you think happens to the picky eaters over there?
    1.0 Albino Black Pastel Pinstripe BP "Menolo"
    0.1 Albino Spider BP "Ginger"
    0.1 Black Pastel Het. Albino "Jasmine"

    1.0 Woma python "Stitch"
    0.1 Woma python "Milo"
    0.1 Woma python "Millie"

    1.0 Blackhead Python
    0.1 Blackhead Python
    0.1 Blackhead Python

    1.0 Black South African Boerboel "Midas"
    0.1 Chocolate Lab "Coco"

  4. #14
    BPnet Veteran enginee837's Avatar
    Join Date
    06-14-2015
    Posts
    557
    Thanks
    134
    Thanked 604 Times in 278 Posts
    Images: 42
    Brings another question, if you are telling me that willingness to feed a bp off because it won't take F/T or because it has a weak feeding response should make me question wether or not I should breed bp's. I would ask you which is more or less humane, feeding a live rat to a snake or a humanely euthanized bp to a snake that prefers eating other snakes/reptiles to rodents? I personally don't see any difference.
    1.0 Albino Black Pastel Pinstripe BP "Menolo"
    0.1 Albino Spider BP "Ginger"
    0.1 Black Pastel Het. Albino "Jasmine"

    1.0 Woma python "Stitch"
    0.1 Woma python "Milo"
    0.1 Woma python "Millie"

    1.0 Blackhead Python
    0.1 Blackhead Python
    0.1 Blackhead Python

    1.0 Black South African Boerboel "Midas"
    0.1 Chocolate Lab "Coco"

  5. #15
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1

    Re: Is a strong feeding response genetic and can it be line bred for?

    Quote Originally Posted by enginee837 View Post
    Oh and by the way, there are places where feeding live is illegal. What do you think happens to the picky eaters over there?
    Like where England? Also that what many think because people believe everything animal activists tell them. It is not legal unless it is made for entertainment or public viewing and or will cause prolonged unnecessary suffering.

    Live feeding is legal people just got convinced otherwise.

    And there are no such laws in the US.

    But again that would be an excuse either way for one not to do the best he can regardless of his beliefs or willingness.

    If tomorrow they make F/T rodent illegal are gonna feed crickets??? I don't think so......or maybe

    Again you chose the worst species to work with when it comes to feeding because sooner or later any given BP will have issues and if you are not willing to feed what works I am not sure that's the right species for you, there are many species that will eat ANYTHING, live, f/t, hot, cold, etc
    Deborah Stewart


  6. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have only breezed over the replies here so I may have missed it but, speaking as a geneticist, the answer to the first question is yes (with a caveat) and the answer to the second question is no (also with a caveat).

    Nearly any trait can be line bred for; large clutch size, rapid growth, size at maturity, age at which the animal breeds, twins... So while it is not likely to be the result of a specific single gene, a strong feed response is certainly something that can be line bred for.

    As far as catering to picky eaters being a disservice... As most have noted, the majority of the time the reason an animal is being picky is because of a husbandry issue which can be resolved with diligence. In the rare case where refusal to eat is genetic, the animal usually solves the issue itself by dying, regardless of what measures are taken to get it to eat. Either that or the animal takes so long to get to breedable size that by the time it does it has been skipped over in favor of a different animal that ate better and so got to size better and so was bred first and so passed on its "better" genes. And, finally, if the poor eater is bred in spite of the fact that it took so dang long to get up to size then inevitably it is going to be bred to an animal that was a better eater and so got to size quickly and so was used for breeding over some other crappy feeder thereby passing on its "better" genes and, hopefully, diluting/offsetting the "poor eater" genes. Which takes us right back to my answer for question one
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    Alicia (02-07-2018),GoingPostal (02-07-2018),Regius_049 (02-07-2018),Timelugia (02-07-2018)

  8. #17
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Is a strong feeding response genetic and can it be line bred for?

    Quote Originally Posted by enginee837 View Post
    I dont believe this is a topic with any scientific study behind so I am looking at more of a discussion based on genetics. So here goes, 2 questions;
    Is a strong feeding response and willingness to eat anything a gene that can be line bred for?
    Is catering to picky/weak eaters rather than culling them doing a disservice to bp's in general?

    My reason for asking is I have seen discussions regarding picky irregular eating habits being a downside of bp's in general however I know they are not all like that. I personally have some that are absolute garbage disposals and some that are a pain in the butt when it comes to what/if they will eat (hatchlings and adults).
    I am far from a expert here. I am a novice when it comes to ball pythons. I have read a lot about their eating habits in a short period of time and there are several things that seam to hold true with Ball pythons. Here are a few of my findings.

    1) Ball pythons are habit forming. I know a local breeder that one of her pythons will not eat rats with red eyes. He had a bad experience with one once. Would he starve if only offered rats with red eyes? Not going to test that. What is offered can also be habit forming for some ball pythons. Rat/mouse/ASF etc.... can lead to food preference.

    2) Different snake can mean taste preference. You like certain foods when you eat so you tend to eat what you like. Some like the taste of one kind or mouse or rat over another. I think this is more personality than genetics.

    3) Learning how to eat. Some babies know instantly what food is and how to constrict it right away. Others have to learn what food is and others how to kill it before eating it. I think that snakes have a learning curve and some (like some people) are more intelligent than others. Not getting into instinct and how much reasoning a BP has but there is a certain level of intelligence that comes into play here.

    4) Husbandry. Some need precise living conditions to eat and survive well in general and this is often directly tied to feeding response.

    5) Breeding season. Some snakes fast during the breeding season because they are looking for a mate and don't have time to stop and eat. It is a drive that can not be ignored in some animals. Sure it is stronger in some BPs than others but it plays a part in eating habits.

    6) Simply not hungry. Most BPs will self regulate diet with need. Some are over eaters. In captivity food is more plentiful than in the wild. This also makes perfect since with the fasting period in winter for most animals when food supply is less. Digestion takes energy. Eating stored fat takes less energy.

    Like I said I am far from expert here but I think genetics plays more a part in survivability than eating response. This is all theory and gathered information.

    Peace....
    Last edited by Skyrivers; 02-07-2018 at 11:15 AM.

  9. #18
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Is a strong feeding response genetic and can it be line bred for?

    Quote Originally Posted by enginee837 View Post
    You are certainly entitled to your opinion however there are plenty of bp's that are more than happy to eat what I want to feed them. Hence the topic, is it possible to breed for this trait.
    This is a classic argument of nature vs nurture. I think truth is somewhere in-between.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1