Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 329

4 members and 325 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,069
Threads: 249,219
Posts: 2,572,797
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    Registered User
    Join Date
    12-06-2017
    Posts
    193
    Thanks
    109
    Thanked 181 Times in 84 Posts

    Black ball pythons

    We are looking into adding another one to the collection in a few months. Me and my daughter both really like the bel’s or the ivory morph. It seems we are leaning towards almost a solid color snake. So we started to wonder are there any full black morphs out there, we did some internet searches but photoshop runs rampant on the internet. So we figured we’d ask are friends around here.

  2. #2
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22
    you'll find most solid-colored dark snakes are supers: super black pastels, super cinnamons, and the super mahogany are the solid-colored dark snakes. i have a super cinnamon myself and she's a beautiful baby. GHI is another morph that comes to mind which can produce some darker-colored combos.

    if you haven't heard or WorldofBallPythons.com yet, i recommend typing things in and clicking around to learn some morphs.

    my super cinnamon paradox, Coffee Bean. she's bigger now than this photo and is starting to get this light speckling and a silvery undertone.
    Last edited by tttaylorrr; 12-13-2017 at 06:22 PM. Reason: info
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  3. The Following 2 Users Say Thank You to tttaylorrr For This Useful Post:

    Albert Clark (12-14-2017),Godzilla78 (12-13-2017)

  4. #3
    Registered User
    Join Date
    12-06-2017
    Posts
    193
    Thanks
    109
    Thanked 181 Times in 84 Posts

    Re: Black ball pythons

    Wow Yours is right up our alley. I showed my daughter and the longest awwwww you could imagine erupted.

  5. The Following User Says Thank You to DandD For This Useful Post:

    tttaylorrr (12-14-2017)

  6. #4
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: Black ball pythons

    Super mohogany, super cinnamon and super black pastel are the closest i have seen to an all black snake.
    If you wanted an all grey. Maybe look at the morph called silver bullet - super pastel super cinnamon. I would even venture to say a patternless mystic potion has a solid color, and maintains that to adulthood but lightens up.
    Hope this helps

    Sent from my SM-G930V using Tapatalk


    Edited to say, i just thought of another option. It isnt a totally black, snake but from what i have seen it maintains the black color really well as an adult. Check out GHI mojaves.
    Last edited by Roux; 12-13-2017 at 08:11 PM.

  7. #5
    BPnet Veteran Aedryan Methyus's Avatar
    Join Date
    11-10-2016
    Location
    Pittsburgh, PA
    Posts
    933
    Thanks
    782
    Thanked 595 Times in 365 Posts
    Images: 7
    I favor all black snakes and all white snakes, too! in fact, my next purchase is going to be a pair of Black Pastel Albinos, along with an extra Black Pastel female, so I can make Blizzards, Black Pastel Albinos and Albinos with one pairing and hopefully some Super Black Pastels with the other female. After much research it seems that Super Black Pastels are the best way to go for Black Ball Pythons. It's my understanding that Black Pastels hold their colors and the Supers don't brown out like others...

  8. #6
    Registered User
    Join Date
    12-06-2017
    Posts
    193
    Thanks
    109
    Thanked 181 Times in 84 Posts

    Re: Black ball pythons

    The amount of knowledge these forums kick out every time I ask a question is mind blowing. You guys are amazing

  9. #7
    BPnet Veteran enginee837's Avatar
    Join Date
    06-14-2015
    Posts
    557
    Thanks
    134
    Thanked 604 Times in 278 Posts
    Images: 42
    Check out ballroom pythons south, he works with super cinnamon and super black pastel regularly. He also has figured out how to create kink free ones with pretty good success. He usually has stuff on morph market and has a facebook page.
    1.0 Albino Black Pastel Pinstripe BP "Menolo"
    0.1 Albino Spider BP "Ginger"
    0.1 Black Pastel Het. Albino "Jasmine"

    1.0 Woma python "Stitch"
    0.1 Woma python "Milo"
    0.1 Woma python "Millie"

    1.0 Blackhead Python
    0.1 Blackhead Python
    0.1 Blackhead Python

    1.0 Black South African Boerboel "Midas"
    0.1 Chocolate Lab "Coco"

  10. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    As people have noted, SuperBlkPastel, SuperCinny and BlkPastel x Cinny (aka 8-Ball) will give you a solid dark snake but be aware that 1) they will become more brown as they age and 2) there is a known issue with kinking and duck-billing in these superforms so if you are trying to breed for them you may end up with some imperfect animals.

    SuperMahogany (aka SUMA) produces a solid dark snake as well, but again, it tends to become brown rather than black as it ages. They also frequently have a hint of a gold dorsal stripe that appears on them.

    JKR made a SUMA Cinny a couple years ago that was pretty dark however I have not seen any pics of it as it matured so no idea if it maintained that darkness.

    Razor x BlkPastel and Huffman x BlkPastel make an interesting superform that is fairly solidly dark with a slate grey dorsal stripe. I have not seen any mature Huffman x BlkPastel but the adult BlackRazors I saw had stayed pretty dark and the stripe had darkened as well.

    SuperGHI Mojave and SuperGHI BlkPastel (or Cinny) can also give you a dark animal with a dorsal stripe though occasionally you get some side pattern markings as well.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #9
    BPnet Veteran dylan815's Avatar
    Join Date
    05-16-2017
    Location
    South Dakota
    Posts
    525
    Thanks
    269
    Thanked 184 Times in 125 Posts
    Images: 3
    I know you're looking for straight color, but ive always loved the "black pastels and the Chocolate pastels".
    1.0 Normal BP
    1.0 Mainland Reticulated
    1.0 High lines Red Tail Boa

  12. #10
    BPnet Veteran Aedryan Methyus's Avatar
    Join Date
    11-10-2016
    Location
    Pittsburgh, PA
    Posts
    933
    Thanks
    782
    Thanked 595 Times in 365 Posts
    Images: 7

    Re: Black ball pythons

    Quote Originally Posted by asplundii View Post
    As people have noted, SuperBlkPastel, SuperCinny and BlkPastel x Cinny (aka 8-Ball) will give you a solid dark snake but be aware that 1) they will become more brown as they age and 2) there is a known issue with kinking and duck-billing in these superforms so if you are trying to breed for them you may end up with some imperfect animals.
    I was actually talking with a local breeder friend of mine about this recently. He works with a lot of Black Pastels and he says that the key to avoiding kinking and duck billing with the supers is to incubate the eggs at lower temperatures for a longer period. He said he uses a completely separate incubator just for them and has had a huge success rate. He incubates his Super Black Pastel eggs at 85 - 86 degrees, which naturally causes them to take longer to incubate and he doesn't cut his eggs...

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1