» Site Navigation
0 members and 1,774 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,082
Threads: 249,221
Posts: 2,572,816
Top Poster: JLC (31,651)
|
-
Registered User
Is it possible for the original carrier of morph to be super co-dominant?
I have been doing some digging but unfortunatelly I couldn't find anything worth mentioning.
Have we ever had a co-dominant morph whose original carrier was the super version of that morph?
Thank you for your feedback and kind regards,
Andrej
-
-
I am not aware of any morph where the first such snake in captivity was the super version. That sort of thing would be pretty rare, but it could happen. All it would take would be two wild ball pythons, each with a mojave mutant gene paired with a normal gene (for example). If those two snakes mated, some of their babies would be blue-eyed whites. And a Blue-eyed white would have to be the first snake with mojave mutant genes to be taken into captivity.
The nearest I know of with codominant mutant genes is the the original platy daddy ball python. Apparently that snake had a lesser platinum mutant gene paired with a daddy mutant gene. He was lighter in color than a lesser ball python, which has a lesser (AKA lesser platinum) mutant gene paired with a normal gene.
-
-
Re: Is it possible for the original carrier of morph to be super co-dominant?
According to vin Russo the first congo was a super congo, however it is considered dominant, not co-dom
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
Albert Clark (10-31-2017)
-
Re: Is it possible for the original carrier of morph to be super co-dominant?
 Originally Posted by OhhWatALoser
According to vin Russo the first congo was a super congo, however it is considered dominant, not co-dom
Cool! Thanks for the information!
A super congo (with a pair of congo mutant genes) has two congo parents, each with (most likely) a congo mutant gene paired with a normal gene. Neither congo parent looks normal. As far as I am concerned, that answers the OP's question with a yes.
-
The Following User Says Thank You to paulh For This Useful Post:
Albert Clark (10-31-2017)
-
If you consider Sentinel and Neo to be inc-dom (there has been a long running debate on them) then both of those came in as visuals as well.
And if you really want to start a heated argument, you could throw Pied on the list.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Albert Clark (10-31-2017)
-
This is sort of like asking which came first, the chicken or the egg LOL. First you have to ask where did the co-dom come from and where did the super come from? I suppose the real question is did we find a super in the wild as the first example of the morph? Obviously you can't get a super without the single gene co-dom form first. But then again you can't get a chicken without the egg and you can't get an egg without the chicken LOLOL.
-
-
Re: Is it possible for the original carrier of morph to be super co-dominant?
The chicken egg debate is easy. The egg came first, it existed well before chickens. And if we want to talk chicken eggs, the egg still came first as it would of had to of been laid by the chickens ancestor to make a chicken.
The single gene would come first, it comes from a gene mutating. Any super to enter captivity would of came from at the very least two single gene parents, either one being the originator and on being offspring, or both being offspring. The chances of two genes mutating in exactly the same way at the same time to make a super the originator is so astronomically high it isnt worth mentioning.
-
The Following 3 Users Say Thank You to OhhWatALoser For This Useful Post:
asplundii (11-01-2017),Godzilla78 (11-04-2017),paulh (11-02-2017)
-
Re: Is it possible for the original carrier of morph to be super co-dominant?
 Originally Posted by OhhWatALoser
The single gene would come first, it comes from a gene mutating. Any super to enter captivity would of came from at the very least two single gene parents, either one being the originator and on being offspring, or both being offspring. The chances of two genes mutating in exactly the same way at the same time to make a super the originator is so astronomically high it isnt worth mentioning.
Just as OWAL says -- the mutation of a single gene happens first. More specifically, a single genetic element in a gamete is mutated and the embryo that then derives from that gamete is the first mutant. That animal then breeds to spread the mutation into the population which gives rise to the opportunity at some point in the future for two individuals that carry the mutation to breed and produce a homozygote.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Godzilla78 (11-04-2017),paulh (11-02-2017)
-
Wasn't an ivory imported? I don't remember hearing about yellow bellies before that. There was a rumor that it cost $150K.
-
-
Re: Is it possible for the original carrier of morph to be super co-dominant?
 Originally Posted by RandyRemington
Wasn't an ivory imported? I don't remember hearing about yellow bellies before that. There was a rumor that it cost $150K.
I do not think so. I think (but am not certain) that TSK was the first to make an Ivory in captivity and RDR kicked himself because he had had his Goblin-line for years before they got their YB line and he had never even thought to even try Goblin x Goblin
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|