Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 776

0 members and 776 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,903
Threads: 249,098
Posts: 2,572,070
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 10 of 21

Threaded View

  1. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I would contend that it depends on a lot of variables that the OP has not provided before an accurate answer can be given; size of rack (6qt? 28qt? 41qt?), set points of rack, differential within the rack, etc...

    I have a pair of GBKs. I was able to easily house them in the bottom tier of a 12 tall x 4 wide 41qt rack system. This did not provide any stress or challenge to the animals because: 1) I run my hot spot about 3 degrees lower than most ball keepers (30 versus 33), 2) the temps at the bottom of the rack tend to be lower than they do at the top of the rack, 3) the depth of the tub offers a wide degree of gradient, 4) I also run my ambient a bit lower than most.

    All of that together makes it easy for me to house the GBKs in the same rack as the balls. Because I know the parameters and the tolerances of the animals.

    Would I try to house an adult GBK in a 6qt baby ball rack running a hot spot of 33 with an ambient of 28? Not for one second!
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Craiga 01453 (11-01-2017),Zincubus (11-01-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1