Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 650

0 members and 650 guests
No Members online
Most users ever online was 47,180, Yesterday at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,899
Threads: 249,095
Posts: 2,572,066
Top Poster: JLC (31,651)
Welcome to our newest member, HellboyBoa
Results 1 to 9 of 9

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Multi-gene clutch help ID

    Quote Originally Posted by fLako0aGuiiLaR View Post
    So no super in the one on top?
    i thought it was a super for the little head blush :o
    Nope, top one is not a Super. Head blushing in a Super is much more pronounced, nothing "little" about it
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (10-18-2017),fLako0aGuiiLaR (10-20-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1