» Site Navigation
1 members and 1,404 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
|
-
Re: Ball python single gene morph descriptions -need feedback
 Originally Posted by reptilelover1995
As for the missing mutants you mentioned, due to the methods I am planning to use, I am not including incomplete dominant mutations (part of why I needed to post this, need to ensure I don't accidentally include incomplete dominant mutations).
If the goal is to weed out the inc-doms that is a bit easier.
Dominant ball morphs:
Calico/Sugar -- Suspected. No visual super produced to date but may have lethal homozygous, data is too spotty to confirm/deny
Congo -- Per Vin Russo
Pinstripe -- Has always been labeled as dominant but there are a couple of breedings that indicate that may not be correct
Leopard -- Suspected but one breeder thinks it may be otherwise
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Thank you! That is very informative. As for Congo, I have still been unable to determine the actual phenotype of the mutant - it looks like a normal to me. Also, was it Vin Russo who first proved out the phenotype? I need that supplemental information for my dataset (didn't include it in the version I posted here because it was not relevant to this particular discussion).
-
-
Registered User
Because the thread will not let me go back and edit my original post, I will post the revised descriptions I've got here.
Clown: Disconnected lateral blotches and broken vertebral stripe completely absent - ventrally connected lateral blotches anteroposteriorly expanded, often merging with one another.
Puzzle: Disruption of ventrally connected lateral blotches, which are anteroposteriorly expanded, sometimes merging with each other to form larger lateral markings. Whitewall is also expanded.
BriteBall: Significant reduction in spotting (based on the few images I could find of single-gene mutants), and the copper color is replaced with a pale yellow. Homozygous form is black eyed leucistic.
Keep in mind that all of these descriptions are using the terminology that I illustrated in the document I shared before, so if something seems unclear, be sure to reference that as it should show what I mean by specific terms.
-
-
Registered User
Sorry to post so many times in a row, but my professor and I have decided now that we are going to incorporate co-dominant/incomplete dominant (whatever you want to call the genes with different heterozygote and homozygote phenotypes) genes/alleles into our analysis. We have figured out a way to incorporate these genes into our analysis (something we previously did not think would be possible), so now I will be trying to create a table similar to those I have already posted, but for those genes. This will take some time, as there is a lot of describing to do (and a lot of double checking to make sure I don't include multiple names of the same genetic mutation), but I will continue to update this thread as I work.
I have also reached out to the original breeders of many of the traits I have described to get their thoughts on phenotype and inheritance, and if I am given permission I will report that information here.
Thanks again for all of the help!
-
-
Re: Ball python single gene morph descriptions -need feedback
 Originally Posted by reptilelover1995
Thank you! That is very informative. As for Congo, I have still been unable to determine the actual phenotype of the mutant - it looks like a normal to me. Also, was it Vin Russo who first proved out the phenotype? I need that supplemental information for my dataset (didn't include it in the version I posted here because it was not relevant to this particular discussion).
An old thread of mine, I think it was called exact effect of congo or something along those lines on here (Sorry I'm on my phone so I can't link it, I'll post the link when I get home or you can go through my past posts if you want) me and another user talked about the effects of Congo and after that I spoke with the breeder who produced my pastel butter congo and he gave me some info as well.
It was developed first by Vin Russo, and it basically acts as a clean up morph. He paired it mostly with pastel and it helps to keep pastels from the colors fading as much and keeps the patterns from muddying up as much.
The breeder who commented on my thread said that it effects each gene it's paired with differently, they worked with fire congo and it brightens up the colors a lot.
One common factor I've seen in all the congo animals I've seen is that they all have a lighter colored head.
Sent from my LG-D690 using Tapatalk
-
-
Registered User
Ah, thank you very much! For some reason I was not notified of the new reply to this thread, despite being subscribed. I will try to add that information into our dataset, I just need to figure out how to phrase it using the terminology illustrated in our document (shared earlier).
By "clean up" do you mean that boundaries between different aspects of the pattern (ie between the lateral blotches and the lateral background coloration) are more defined? And by lighter head, are you referring to the cranial patterning? If so, what color is it? I need to be explicit in my descriptions for them to be meaningful.
Also, like I said I am currently working on drafting up a dataset for the co-dominant (or incomplete dominant, whatever you want to call them) morphs. I am doing as much research as I can, using WOBP for names and some basic info, and cross-referencing via any references I can find through Google or searches on here. However, as I have had less time to work on these relative to the "dominant" and "recessive" mutants, that may be reflected somewhat in my knowledge of phenotypes and possible inclusions of multiple names for single genes. I am trying to eliminate that pseudoreplication, so you will notice that I will not be including more than one "Pastel"-type entry (obviously discounting black pastel, which is different), or "yellowbelly", though there may be some copies I thought were different but that I missed. If there are any that I missed and are actually different from the ones that I list, please feel free to let me know and I will include them.
I'm hoping to have my first draft ready in the next week or two.
-
-
Registered User
It has taken a long time due to a majorly busy schedule (lots of lab work and whatnot), but I have finally worked up a rough draft of all of the co-dominant mutations. Right now, our goal is to validate all of our current descriptions (this includes ones included earlier in this thread) - we want to ensure that our descriptions are accurate, and that the inheritance we list them under is accurate. One thing of note: We are NOT including different lines of the same mutant phenotype, unless those two lines display complementation (ie the different lines of axanthic). As before, those with a question mark were ones I could not describe due either to an inability to distinguish from a wildtype, or simply a lack of adequate photographs to distinguish the phenotype. For terminology, see the document I posted earlier in the thread. Thanks again for any help!
| Alloy |
Heterozygous form has small black spots running along the margins of the ventral scutes. Homozygous form replaces copper coloration with shades of orange [appears to have some sort of aberrant pattern] |
| Arctic |
Possible dorsal expansion of ventral coloration, and/or expansion of whitewall. This is exaggerated even further in the homozygote. |
| ARP |
Lateral blotches tend to expand dorsally over the spine, and disconnected lateral blotches are absent. The typical broken vertebral stripe is largely absent (though it may remain in the anterior third of the body, and disconnected blotches on the spine may be remnants of the broken vertebral stripe. Spots are larger in size and greater in number than in the wildtype. There is a lighter brown arrowhead shape within the cranial patterning, with a single black spot occuring just posterior to the parietals. |
| Arroyo |
Cannot adequately describe heterozygote form, but homozygote form displays a far more connected vertebral stripe, with some irregular black or dark brown spots occuring within it. Additionally, ventrally connected lateral blotches are anteroposteriorly reduced. However, there is significant intrusion of the normal copper coloration into the lateral background coloration. |
| Asphalt |
|
| Bald Gene |
Increased number of lateral blotches, possibly also replacement of vertebral stripe with blotches, lateral background exhibits greater intrusion of paler colors between blotches, expanded whitewalls around blotches. Homozygous form is black eyed leucistic. |
| Bamboo |
In heterozygote, areas that would normally be copper are instead a vibrant silver, with a dark gray dorsal background coloration. Lateral blotches appear to be faded or possibly absent altogether. Eyes are blue. Homozygous form is blue-eyed leucistic. |
| Banana |
Highly similar to other albino-like alleles, but this one is sex-linked. Phenotype is orange or yellow instead of copper, lavender or purple replacing areas that would normally be black or dark brown. Small black spots may accumulate over the animal with age. |
| Black Head |
Brown blotches normally forming broken vertebral stripe are more widely spaced along the A-P axis, with anteroposterior expansion of lateral background coloration along the flanks. Near-absence of disconnected lateral blotches. Homozygote increases reduction of vertebral stripe and AP expansion of lateral background coloration. |
| Black pastel |
Very similar to the Cinnamon phenotype - according to one hobbyist, black pastel can be distinguished by the irregular margins and black speckling found within the ventrally-connected lateral blotches. Homozygous form is a black or extremely dark brown snake with an off-white ventral coloration. |
| Blade |
Ventrally-connected lateral blotches anteroposteriorly expanded, forming irregular bands across the body. Vertebral stripe appears greatly reduced or absent, and there is a reduction in the number of spots. |
| Blitz |
There are a greater number of blotches in this phenotype, which are smaller than in the wildtype, and most are single-spotted. Additionally, spots may occur within some areas of the broken vertebral stripe.s |
| Blonde Pastel |
Existing line of the "pastel" mutant phenotype |
| Bongo |
Very similar to the Genetic Stripe mutation, I cannot adequately describe the heterozygous form, but the homozygous form has a thin, light peach-colored dorsal stripe, flanked by thin black stripes. These black stripes are in turn flanked by a reddish-brown stripe that extends approximately a third of the way down the flanks of the animal. The rest of the flanks, and the vent of the animal are a whitish-pink color. The first third of the animal's length also has a second, somewhat faded reddish brown lateral stripe approximately halfway between the ventral surface and the ventral margin of the red stripes on the dorsum. The cranial pattern is reddish-brown, and the ocular stripe is absent anterior to the eye. Posterior to the eye, it is a whitish-pink color. |
| Brite Ball |
Significant reduction in spotting, and the copper color is replaced with a pale yellow. Homozygous form is black eyed leucistic. |
| Butter |
Shades of copper in wildtype are lighter in coloration in this mutant, with increased intrusion of these colors into lateral background coloration. Homozygous form is blue-eyed leucistic. Is identical in phenotype to "Lesser". |
| Cajun |
? |
| Callisto |
? |
| Champagne |
Heterozygous form has almost no black patterning, leading to a largely bronze or gold colored snake. There is an extreme degree of variation within individuals - some have large, dark rings distributed along the body, others may have a partial or even complete dorsal stripe, etc. Homozygous form is fatal. |
| Charcoal |
? |
| Chocolate |
? |
| Cinnamon |
According to hobbyists, Cinnamon often imbues a somewhat reddish hue to the animal with a chocolate-colored background coloration, a clean vent (no markings), and single spotted ventrally-connected lateral blotches that form the shape of a keyhole (dorsal expansion and ventral constriction of the ventrally-connected lateral blotches). A similar type of pattern is seen in the Black Pastel mutant, but according to hobbyists, the whitewalls of the ventrally-connected lateral blotches are more clearly delineated in Cinnamon. |
| Coral Glow |
Same gene as Banana, and identical in phenotype. |
| Disco |
? |
| Enchi |
Lateral blotches are anteroposteriorly expanded, and lead to a decrease in lateral background coloration; coloration is brighter than in the wildtype (more golden-yellow than copper), and the whitewalls and darkwalls tend to be highly faded. The homozygote is far brighter in coloration, and lateral background coloration is further reduced than in the wildtype. |
| Fire |
Spots are fewer in number than in wildtype, and ventrally-connected lateral blotches occasionally expand dorsally to form irregular bands. According to hobbyists, color is somewhat lighter than wild-type, with a creamy-gold coloration. Homozygous form is black-eyed leucistic. |
| Flare |
Seems identical in both heterozygous and homozygous form to the Yellowbelly morph. |
| Ghi |
Ventrally-connected lateral blotches display a large number of very small black spots, along with an irregularly shaped central spot. Cannot adequately describe homozygote. |
| Glossy |
? |
| Goblin |
? |
| Granite |
Ventrally-connected lateral blotches have many small, dark brown or black markings within them. In some individuals, the blotches forming the broken vertebral stripe are anteroposteriorly expanded, giving the stripe a more "connected" look. This is further exaggerated in the homozygote. |
| Gravel |
Unable to describe heterozygote phenotype, but the homozygote is largely an orange-red color, with orange-yellow makings that form a broken vertebral stripe, and irregularly shaped disconnected lateral blotches. |
| Het Red Axanthic |
Blotches forming broken vertebral stripe are fewer in number, leading to a largely black dorsum. Blotches appear to have a reduced degree of yellow pigmentation in comparison to the wildtype, and there are more spots within the lateral blotches. Homozygous phenotype has a similar lighter coloration to other lines of axanthic, but has an altered pattern as well. In addition to the pattern alterations seen in the heterozygote, the homozygote has a broken ocular stripe, giving the appearance of two light brown spots above the nasal scales. |
| Hidden Gene Woma |
Phenotype is nearly identical to the "woma" mutation, hence the name. Could not find any images of homozygote - is apparently lethal early in life. |
| Huffman |
The boundary between the ventrally-connected lateral blotches and the whitewalls is more clearly defined in this phenotype, and there is an increased intrusion of browns into the lateral background coloration. Lateral blotches have an increased number of irregularly shaped spots, as well as numerous small black markings. |
| Hurricane |
All ventrally-connected lateral blotches have a single large spot, and multiple very small black spots. In the homozygote (called Hayabusa), the ventrally-connected lateral blotches appear to be heart-shaped, as do the large single spots within them. Numerous small black markings are present within the ventrally-connected lateral blotches, as in the heterozygote. |
| Hydra |
? |
| Java |
? |
| Jedi |
? |
| Josie Ball |
Expansion of ventral whitewall. Three faded light brown spots form a triangle within the normal cranial patterning - with the "point" of the triangle pointing posteriorly. There is also an increased number of spots, largely within the dorsal regions of the ventrally-connected lateral blotches. |
| Jungle Woma |
Much more yellow coloration in areas that are normally copper in the wildtype, and expanded blotches of all types, further breaking up the background coloration. Reduction in black coloration is further exaggerated in homozygote. |
| Lace |
? |
| Lace Black Back |
Blotches forming the broken vertebral stripe are far fewer in number, leading to a largely uninterrupted dorsal background coloration; possibly with a greater number of single-spotted lateral blotches. Homozygous form shows anteroposterior expansion of single-spotted ventrally-connected lateral blotches, which expand into each other to form largely brown flanks with dark brown or black spots. |
| LC Black Magic |
|
| Lemonback |
Nearly identical to the "Fire" phenotype, but with a dark spot in the cranial patterning not present in the Fire, according to breeders. Homozygote is black-eyed leucistic. |
| Leopard Ball |
Lateral blotches of all types are far larger both anteroposteriorly and dorsoventrally than in wildtype, often connecting to each other to form large, irregularly shaped brown bands. There is a greater number of spots than in the wildtype, and these largely occur on the dorsal sides of the flanks. The remnants of the broken vertebral stripe can be observed just behind the neck, and from the vent to the tip of the tail. Often there are multiple irregular black spots distributed along the ventral scales. |
| Lesser |
Identical in phenotype to Butter mutant. |
| Lori |
Heterozygote is extremely difficult to describe in terms of phenotype, is apparently very subtle according to breeders. According to breeders, Homozygote starts out with an axanthic coloration, then accrues brown colors with age. [Pattern is clearly aberrant in homozygote, but cannot adequately describe it] |
| Mahogany |
Cannot adequately describe heterozygote form, but homozygote form is a completely dark brown or black snake, as in Cinnamon and Black Pastel mutants, but with an orange stripe running down the dorsum, sometimes quite bright. Possibly on the same locus as Black Pastel and Cinnamon, but does not result in a completely black snake when combined with cinnamon or black pastel. |
| Mandarin |
? |
| Mocha |
Could not find any pictures of homozygote, heterozygote is difficult to describe. |
| Mojave |
Blotch coloration is often lighter than in wildtype, with increased intrusion of browns into the dorsal and lateral background colorations. Furthermore, there are a greater number of single-spotted lateral blotches than in the wildtype, and fewer double or multi-spotted ones. According to WOBP description, another trait of Mojaves is a completely white underbelly. Homozygote is blue-eyed leucistic. However, occurring to at least one BP.net user (JLC), the homozygous form of Mojave is different from that of other BEL-complex alleles such as Butter, in that it has a more silver cranial patterning and there may be remnants of black patterning showing as a very faint gray. [Would be interesting to see if any remnants of pattern remain if examined under UV] |
| Mystic |
Heterozygote appears rather similar to Mojave, but the homozygote has a yellowish-white broken vertebral stripe, with white ventral coloration extending dorsally halfway up the flanks, and dorsal background coloration is a dark purple. Midway down the flanks, there are a series of yellowish white, single-spotted disconnected lateral blotches. Ventrally-connected lateral blotches are present, but are extremely subtle, and are dorsally reduced. Eyes are blue in homozygote. |
| Nanny Ball |
The margins of the lateral blotches of all types are far more irregular than in a wildtype, and all have multiple small, irregular spots within them. The vertebral stripe is also more broken than in the wildtype, consisting of a greater number of shorter segments. |
| Orange Dream |
Appears to replace the typical copper color with a more orange coloration, though some individuals appear brown. Homozygote is far more orange. |
| Paint Ball |
Cannot adequately describe heterozygote form, but homozygote has an extremely increased intrusion of copper into the dorsal and lateral background coloration, and a large amount of small black markings within the lateral blotches, giving a speckled look to the flanks. |
| Pastel |
Intensified yellow pigmentation to various degrees, that tends to "brown out" with age. The homozygote has a more yellow coloration that tends to fade less with age, reduced black patterning, faded cranial pattern, and an intrusion of white or pale purple coloration into the lateral and dorsal background coloration. Some may have green eyes. |
| Phantom #2 |
? |
| Quake |
|
| Raven |
Expansion of all black or dark brown coloration, including darkwalls, dorsal background coloration, and spots. According to the original breeder, this is even more extreme in homozygous form. |
| Red Stripe |
Increased connection in vertebral stripe, copper coloration is more red than in wildtype according to one source, and blotches are larger, leading to reduced dorsal and lateral background coloration. Could not find any information on homozygote phenotype. |
| Russo Het Leucistic |
Very subtle in heterozygous form - cannot discern phenotype. Homozygote is blue-eyed leucistic. |
| Sable |
Within ventrally-connected lateral blotches, there is a large number of small black markings, and each of these blotches contains a single black spot of varying shape. In the homozygote, the ventrally-connected lateral blotches are farther apart from one another, separated by the dark brown or black lateral background coloration. The spots in the ventrally-connected lateral blotches appear to be larger than in the heterozygote, and the small black markings are greater in number. |
| Satin |
|
| Saturn |
? |
| Scaleless Head |
There is a patch on top of the head stretching from behind the frontals, forward to the internasals, that is devoid of scales. The homozygote is a completely scaleless snake. |
| Shredder |
? |
| Spark |
Appears to have an aberrant heterozygote phenotype that is difficult to describe. Homozygote has patterning similar to the Genetic Stripe and Bongo mutants, with a light peach lateral coloration, and a tan vertebral stripe flanked by broken stripes of dark purple, which have irregular margins. Lower along the flanks, there are a great number of very small, dark purple markings, forming a speckling pattern. This color also forms a broken outline of the wildtype cranial pattern, which is otherwise the same color as the flanks, with a few spots of dark purple showing through. |
| Special |
Heterozygote form has a more broken vertebral stripe than is commonly observed in the wildtype, and ventrally-connected lateral blotches extend dorsally over the spine in some areas, forming broken bands. Whitewall is far more distinct from blotch coloration than in wildtype. In the homozygous form, the wildtype coppers are replaced with white or very light tan-orange, while what would normally be black is replaced by a peach-orange color. The eyes are blue in the homozygote, as in other BEL-complex homozygotes. There also appear to be some white spots within the cranial patterning. |
| Speckled |
Heterozygote phenotype is unclear, homozygote has highly irregular margins in the markings of the broken vertebral stripe, as well as a great number of very small black markings within the lateral blotches. |
| Specter |
Heterozygote phenotype is unclear. Homozygote has a wide, unbroken tan vertebral stripe extending from the base of the head, flanked by two slightly thinner black stripes. The lateral background coloration is a cinnamon color as opposed to the black or extremely dark brown found in the wildtype, and the darkwalls that normally accompany this coloration are extremely reduced or entirely absent. |
| Spider |
Largely brown or tan rather than black, with white or off-white ventral coloration extending dorsally - where the two colorations meet, the pattern takes on a pixelated appearance, with many small specks of white, tan, and brown. Black patterning forms very thin partial bands in some areas, as well as dorsal and lateral spots of varying size. There is a black band going across the internasals, which projects laterally to the nasals where it becomes a lateral stripe. This stripe extends posteriorly through the eye to the rearmost supralabial, where it then projects ventrally to posteriormost infralabial. Two stripes also project posteriorly from the internasals, extending to the frontals. |
| Spotnose |
Heterozygote has a greater number of lateral blotches and spots within these blotches than the wildtype, along with distinct brown cranial markings [cannot describe the shape]. The tip of the snout may or may not have a spot, but this may occur in normal animals as well. Homozygote has a similar pattern to the wildtype, but with an even greater number of lateral blotches and spots than the heterozygote, and there is a large blotch covering much of the normal cranial background coloration. Top of cranium extensively patterned with blotchlike coloration, revealing only isolated dark brown or black spots along the lateral margins Cranial background coloration is only visible as isolated dark brown or black spots along the lateral margins of where this pattern would normally occur, sometimes with one or two small spots on the posterodorsal surface of the head. There are also two dark spots on the nasal scales. The coppers and browns found in the wildtype are instead replaced with sulphur yellows. |
| Taronja |
Uncertain on the phenotype of this morph due to low number of individuals. The heterozygote appears to have orange blotches rather than copper, and homozygote appears to have a similar color change, but in addition to this, the ventrally-connected lateral blotches are anteroposteriorly expanded, leading to almost completely orange flanks. At least one individual of the heterozygote phenotype has diffuse white speckling along the ventrolateral surface, but this may not be characteristic of this phenotype as it is not seen in any of the others. |
| Trick |
This phenotype has a greater number of lateral blotches (both disconnected and ventrally-connected), and almost every single blotch has at least a single spot, with most ventrally-connected lateral blotches having two or three. |
| Vanilla |
Heterozygote appears lighter in color than the wildtype, and actually gets lighter during the life of the animal, according to breeders. There is an intrusion of brown into the cranial patterning. The homozygote has lighter yellows in place of brown coloration, and increased intrusion of these colors into the lateral and dorsal background coloration. |
| X-treme Gene |
Heterozygote phenotype unclear - Homozygote has wide, unbroken vertebral stripe extending from the back of the head to the tip of the tail; Spots are present within this broad vertebral stripe; ventrally-connected lateral blotches anteroposteriorly expanded, sometimes to the point of merging, resulting in reduced lateral background coloration. |
| Yellow Belly/Ivory |
Heterozygote phenotype similar to wildtype and in some cases difficult to distinguish from wildtype; however, most individuals exhibit more coloration between typical lateral blotches than wildtype, in some cases involving laterally connected pale blushes and in others involving blotch-like ventrally connected pale markings surrounded by intense black scales but lacking whitewalls (these markings referred to as "flames" by one hobbyist); scutes also particularly patternless relative to wildtype, but scales immediately adjacent to scutes appearing to exhibit more intense checkerboard patterning than wildtype. Some hobbyists have reported "a marking on the top of the head." Homozygote phenotype is pinkish white and largely lacking pattern outside of a thin, nearly continuous yellow vertebral stripe extending from the back of the cranium to the tip of the tail and, at least in some cases, pigmentation on the dorsal surface of the cranium involving either large discrete patches of yellow, diffuse pigmentation across the dorsal surface of the head, or diffuse dark pigmentation flanked by thick yellow ocular stripes extending from the back of the cranium to the inter-oculars. |
| Sulfur |
Unclear phenotype in heterozygote. Homozygote is a black-eyed leucistic, but some may develop patches of yellow or orange (similar to piebaldism). |
-
-
Registered User
Sorry to double post, but I really need feedback to ensure that my descriptions and inheritance pattern data are verified, as any statistical analyses I do using this data are only useful if the data itself is accurate. Please let me know if I have missed anything in inheritance patterns, or even just confirming that descriptions are accurate is useful, as it allows me to move them into the dataset of verified morphs.
-
-
I see you don't have a description for Asphalt. That's one morph that I find very interesting, most people would consider it co-dominant having a super form. However, even the trained eye can't tell if you have an Asphalt or a Normal. In my mind this would be a recessive gene, the super being the recessive visual. The Gravel is similar, I think they are just different lines of the same morph, the Asphalt being discovered in Canada, the Gravel in the US. I'm pretty sure both were discovered by accident when pairing up with Yellowbelly to create the very impressive allelic Highway and Freeway complexes.
There are several morphs that I've never heard of before, I wonder if some were named based on a single individual and then not proven genetic? (Alloy, ARP, Arctic, etc..)
Chocolate is a dark snake, super Chocolate is even darker.
Disco is a 'lightener' or enhancer, similar to Fire or Xtreme Gene. It's allelic to Fire and a Disco Fire is a white snake (in the same complex).
Blade is interesting... It's usually only associated with the Clown gene. I think it was originally used to describe a reduced pattern Clown. I've often wondered it it's actually Enchi. I've seen Enchi Clowns and they look exactly like a Blade Clown.
I think 'LC Black Magic' may be multiple genes. Not sure what the LC means but a Black Magic is Black Pastel + Mojave.
Scaleless Head may not be missing any scales on the head, it may have 'micro scales'.
Last edited by cchardwick; 11-21-2017 at 11:54 AM.
-
The Following User Says Thank You to cchardwick For This Useful Post:
-
Registered User
Thank you for your reply! As you note, many of these things have only a single photograph associated with the entry (or none at all), which makes me hesitant to include them in my dataset as, like you said, they may not be genetic at all. These are the types of things I am trying to remove from my dataset, so that I am only including mutants with clearly established inheritance patterns and understood phenotypic alterations. I may end up removing any mutants with fewer than 2 individuals known from the dataset.
With respect to disco being a "lightener" gene, do you mean that it lightens all coloration (blotch coloration AND background coloration), or just one particular aspect of the coloration?
With chocolate, I'm guessing you are referring to brown coloration being darker? I just want to make sure I have the right understanding when I am writing revised descriptions.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|