» Site Navigation
0 members and 1,531 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
|
-
Registered User
Re: Ball python single gene morph descriptions -need feedback
Thanks for the additional info. I have been working on this for a while, but it has been difficult to find time to focus down on it. I'm glad I've made this post, as it has already helped me gather important info.
As for the missing mutants you mentioned, due to the methods I am planning to use, I am not including incomplete dominant mutations (part of why I needed to post this, need to ensure I don't accidentally include incomplete dominant mutations).
Thanks again!
-
-
Re: Ball python single gene morph descriptions -need feedback
 Originally Posted by reptilelover1995
As for the missing mutants you mentioned, due to the methods I am planning to use, I am not including incomplete dominant mutations (part of why I needed to post this, need to ensure I don't accidentally include incomplete dominant mutations).
If the goal is to weed out the inc-doms that is a bit easier.
Dominant ball morphs:
Calico/Sugar -- Suspected. No visual super produced to date but may have lethal homozygous, data is too spotty to confirm/deny
Congo -- Per Vin Russo
Pinstripe -- Has always been labeled as dominant but there are a couple of breedings that indicate that may not be correct
Leopard -- Suspected but one breeder thinks it may be otherwise
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Thank you! That is very informative. As for Congo, I have still been unable to determine the actual phenotype of the mutant - it looks like a normal to me. Also, was it Vin Russo who first proved out the phenotype? I need that supplemental information for my dataset (didn't include it in the version I posted here because it was not relevant to this particular discussion).
-
-
Re: Ball python single gene morph descriptions -need feedback
 Originally Posted by reptilelover1995
Thank you! That is very informative. As for Congo, I have still been unable to determine the actual phenotype of the mutant - it looks like a normal to me. Also, was it Vin Russo who first proved out the phenotype? I need that supplemental information for my dataset (didn't include it in the version I posted here because it was not relevant to this particular discussion).
An old thread of mine, I think it was called exact effect of congo or something along those lines on here (Sorry I'm on my phone so I can't link it, I'll post the link when I get home or you can go through my past posts if you want) me and another user talked about the effects of Congo and after that I spoke with the breeder who produced my pastel butter congo and he gave me some info as well.
It was developed first by Vin Russo, and it basically acts as a clean up morph. He paired it mostly with pastel and it helps to keep pastels from the colors fading as much and keeps the patterns from muddying up as much.
The breeder who commented on my thread said that it effects each gene it's paired with differently, they worked with fire congo and it brightens up the colors a lot.
One common factor I've seen in all the congo animals I've seen is that they all have a lighter colored head.
Sent from my LG-D690 using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|