Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,674

0 members and 1,674 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Results 1 to 3 of 3
  1. #1
    BPnet Veteran Potatoren's Avatar
    Join Date
    07-20-2017
    Posts
    299
    Thanks
    79
    Thanked 392 Times in 169 Posts

    Question on spotnoses

    Do all spot nose ball pythons have two spots on their nose/upper lip?
    Do any other morphs have those spots?
    Can they occur in a fire?

    I'll have to get pictures of his face, but my fire het axanthic adult male has two spots on his upper lip like a spot nose would, but i dont work with spot nose and pictures online havent helped lol.


    Sent from my SM-G920P using Tapatalk

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The Spotnose morph is more than just about a spot on the nose, the mutation also alters the patterning of the whole animal.

    And yes, spots on the nose can occur on other morphs, and also on WT
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    Potatoren (09-19-2017)

  4. #3
    BPnet Veteran Potatoren's Avatar
    Join Date
    07-20-2017
    Posts
    299
    Thanks
    79
    Thanked 392 Times in 169 Posts

    Re: Question on spotnoses

    Quote Originally Posted by asplundii View Post
    The Spotnose morph is more than just about a spot on the nose, the mutation also alters the patterning of the whole animal.

    And yes, spots on the nose can occur on other morphs, and also on WT
    Thanks! I forgot this thing had a search function, so I used it and read up more, he doesnt have the head stamp but I love his little snoot marks regardless

    Sent from my SM-G920P using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1