» Site Navigation
1 members and 817 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Registered User
Are morphs more than a colour scheme?
I am wondering if there are any genetic differences between morphs other than basic colouring? I'm thinking size, temperament, eyesight, hearing, striking power/speed, muscular strength, movement differences etc.
-
-
Re: Are morphs more than a colour scheme?
Well I can give you one example: the spider gene. Sometimes if a snake has the spider gene they get a "head wobble". This doesn't really hurt them, and they can be completely happy and healthy, it just makes their movements a little odd, sideways (sometimes), and well, wobbly!
as for other morphs? I'm not sure, but there is probably some other examples the more experienced hobbyists/breeders on here can give you.
Dewey
He ain't scare of no things
-
-
other than birthing, reproductive and neurological issues, ball python morphs do not affect anything but their looks.
the Desert gene female cannot reproduce and she will either not produce viable eggs, or die while passing eggs.
the Spider gene comes with a neurological affliction that causes their famous wobble.
some genes, when crossed, produce babies that are inviable or are more prone to life-threatening defects, such as Super Spider (lethal), Caramel Albino (kinking), or Champagne x Spider pairing (lethal).
Last edited by tttaylorrr; 09-11-2017 at 01:58 PM.
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
The Following 3 Users Say Thank You to tttaylorrr For This Useful Post:
Craiga 01453 (09-11-2017),PokeyTheNinja (09-11-2017),Vipera Berus (09-13-2017)
-
Re: Are morphs more than a colour scheme?
 Originally Posted by tttaylorrr
other than birthing, reproductive and neurological issues, ball python morphs do not affect anything but their looks.
the Desert gene female cannot reproduce and she will either not produce viable eggs, or die while passing eggs.
the Spider gene comes with a neurological affliction that causes their famous wobble.
some genes, when crossed, produce babies that are inviable or are more prone to life-threatening defects, such as Super Spider (lethal), Caramel Albino (kinking), or Champagne x Spider pairing (lethal).
Just as I said, more knowledgable people lol. Besides tttaylorrr knows her stuff, always really helpful :3. Thanks for the info! I learned somethin' new too haha. Never knew that reproductive issues can be the result of certain morph genes
Last edited by GiddyGoat; 09-11-2017 at 02:01 PM.
Dewey
He ain't scare of no things
-
-
yes, morphs are more than basic coloring. for example, morphs are also a pattern scheme.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Is there anything to the statement that piebalds have a tendency to be more difficult feeders than other mutations? I know my two pieds give me more fits than my other snakes, but it is pretty small testing pool.
-
-
Known issues:
Spider, Woma, HGW, Champagne, Spotnose, Sable, Cypress (and I will assume Bongo) -- Neuro to some degree or other
Spider, Woma, Champagne, HGW -- Lethal super form
Champagne x Sable, Spider x Woma, Champagne x Spider, Champagne x Woma, Champagne x HGW -- Lethal or severe impairment
Caramel, SuperBlk, SuperCinny, 8Ball -- Kinking
SuperBlk, SuperCinny, 8Ball -- Duckbill
SuperLesser/Butter -- Bug-eye
Pied with BluEL complex -- Microphthalmia
Desert -- Female breeding issues
Rumoured/anecdotal/unsubstantiated:
Pied/het Pied -- Problem feeders
Spider, Woma -- Extra strong feed response
Desert -- Delayed development and/or dwarfism
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Are morphs more than a colour scheme?
 Originally Posted by asplundii
Known issues:
Spider, Woma, HGW, Champagne, Spotnose, Sable, Cypress (and I will assume Bongo) -- Neuro to some degree or other
This is news to me, who have you seen report this?
-
-
This is the first time I've ever heard of problems with the cypress gene. I've also heard that all black ball pythons are super aggressive. And my lesser pied has really small eyes but doesn't seem to affect her at all. I have quite a few spider genes, some of them have a head wobble and some of them don't. All of them feed perfectly fine, I just keep them away from deep water LOL. I have a lot of pieds, all of them seem to feed fine.
Last edited by cchardwick; 09-12-2017 at 01:25 PM.
-
-
World of Ball Pythons has a picture of a scaleless ball python. Scaleless is found in several other species, too.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|