Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 612

2 members and 610 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 31
  1. #21
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider x Spider results

    So as expected, they passed. I took some pictures so we can have more than 1 picture in the hobby of a more than likely super spider. I even ran a black light over them, nothing interesting to report. Only color is on the head and a little yellow on the side of the neck. I notice all 3 of the white snakes have kinking issues on the 2nd half of their body. Got this one in the fridge now and will take them up to the vet later today.





    Quote Originally Posted by Albert Clark View Post
    Wow! Very interesting bc I recently did a pairing of a Candino / Albino pairing that produced 5 good eggs. The eggs incubated well @ 87.5 F -88.5 F with a constant 99% humidity . Unfortunately at about day 40 I noticed some discoloration on one of the eggs. This particular egg was on the bottom of the clutch with three other eggs attached to it so it was difficult to access the discolored egg. The progression of the discoloration became much more evident and apparent that the egg was bad. The other eggs were totally fine and hatched with healthy babies. Two visual Candinos and two visual Albinos. They pipped at day 57 and the bad egg at that point was very discolored and smelly. Curiosity made me cut the egg after all the hatchlings were out and it was a underdeveloped white snake with a large hardened yolk at the bottom of the egg. Looking very much like this white snake. I didn't take photos of it bc I wasn't going to post it but I did talk about it in my thread about the clutch results. I was thinking that bc of the allelic mutation of the two genes that may have had something to do with it? That maybe the pairing of a Candino/ Albino was just not the best choice? The four survivors are so far doing well and seem ok.
    I don't think I would draw any correlations from it. Genetically there is zero different between a Candino made from a Albino and Candino vs a het candy and a het albino. I think all of us eventually run into under developed white snakes, I'm sure there is a list of reason it can happen, most being out of our control. Out of all my spider x spider trails, I have always produced at least 1. So far this season, my only bad eggs have been this clutch and my cinny het lavs. Which those cinnys have been a problem pairing for me also, will probably be my last time pairing them also. But last year I even had a bad egg with an under developed white snake from a lemonblast het hypo x het hypo. common genes with no reported issues. it happens.
    Last edited by OhhWatALoser; 09-10-2017 at 10:43 AM.

  2. The Following 3 Users Say Thank You to OhhWatALoser For This Useful Post:

    Albert Clark (09-10-2017),Godzilla78 (09-10-2017),PitOnTheProwl (09-11-2017)

  3. #22
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    and apparently spider is dominant now...... 4:05 in.

    Last edited by OhhWatALoser; 09-10-2017 at 11:47 AM.

  4. #23
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Spider x Spider results

    Watched the video. IMO, just talking is a poor way to present genetics material. Adding pictures would be helpful. Markus Jayne has similar material in text on his web page. Adding pictures there would also be helpful but less helpful than when just using voice. See http://ballpython.ca/genetics-101/

    For codominance vs. incomplete dominance, there is a technical difference in genetics texts, but the two are easy to confuse in practice. Actually, as we herpers use the term "codominance", it means something like "could be technically incomplete dominance or technically codominance, but I don't know which."

    Kevin did not give any evidence to support the claim that spider is a dominant gene. So I will continue classifying it as not recessive, possibly (probably?) lethal when there are two spider genes in the gene pair.

  5. The Following User Says Thank You to paulh For This Useful Post:

    Albert Clark (09-11-2017)

  6. #24
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider x Spider results

    Quote Originally Posted by paulh View Post
    Watched the video. IMO, just talking is a poor way to present genetics material. Adding pictures would be helpful. Markus Jayne has similar material in text on his web page. Adding pictures there would also be helpful but less helpful than when just using voice. See http://ballpython.ca/genetics-101/

    For codominance vs. incomplete dominance, there is a technical difference in genetics texts, but the two are easy to confuse in practice. Actually, as we herpers use the term "codominance", it means something like "could be technically incomplete dominance or technically codominance, but I don't know which."

    Kevin did not give any evidence to support the claim that spider is a dominant gene. So I will continue classifying it as not recessive, possibly (probably?) lethal when there are two spider genes in the gene pair.
    I did ask him on Youtube and Facebook what he did to prove out a super spider, as he told everyone for years it didn't exist. Always welcome new info, but I still see the evidence as overwhelming on the lethal side. I mean explain the above animal, it's not the typical under developed white snake we see, it has color, just like toms.

    I did bring the animal to the vet earlier, will report the results when I get em.

  7. The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:

    Albert Clark (09-11-2017),paulh (09-11-2017)

  8. #25
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    Actually a thought, if someone is that confident you can make a super spider, they could breed a bh spider to a bh spider, only 3 different phenotypes possible. No proving out necessary.

  9. The Following User Says Thank You to OhhWatALoser For This Useful Post:

    paulh (09-11-2017)

  10. #26
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    I guess no one told Kevin about the super pinstripes that BHB has been producing. It makes me wonder if someone will be able to get a super spider someday too.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  11. #27
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spider x Spider results

    Quote Originally Posted by OhhWatALoser View Post
    and apparently spider is dominant now...... 4:05 in.
    So despite all of the documented evidence to the contrary, NERD still insists Spider is simple dominant?? SMH... The final part of that video title says volumes -- "a bunch of nonsense"

    Quote Originally Posted by OhhWatALoser View Post
    Actually a thought, if someone is that confident you can make a super spider, they could breed a bh spider to a bh spider, only 3 different phenotypes possible. No proving out necessary.
    This would be great, unfortunately there are very few people out there interested in breeding for anything other than making more combos
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. #28
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider x Spider results

    Quote Originally Posted by asplundii View Post
    This would be great, unfortunately there are very few people out there interested in breeding for anything other than making more combos
    If someone wants to donate 1.1 bh spiders, I have no problem raising them and breeding them. Just a little too high of price range for an experiment that I'm already pretty confident of the results.

  13. #29
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider x Spider results

    Quote Originally Posted by asplundii View Post
    So despite all of the documented evidence to the contrary, NERD still insists Spider is simple dominant?? SMH... The final part of that video title says volumes -- "a bunch of nonsense"
    Yup and then my favorite is the people who claim they have done tons of breedings, yet offer nothing beyond that. Funny how we've been looking into this issue for years now, yet everyone on fb has all the answers already. This one I like because of the supposed number of breedings. Condescending statements and nothing to show for it.

    Last edited by OhhWatALoser; 09-12-2017 at 11:45 AM.

  14. #30
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: Spider x Spider results

    Quote Originally Posted by OhhWatALoser View Post
    Yup and then my favorite is the people who claim they have done tons of breedings, yet offer nothing beyond that. Funny how we've been looking into this issue for years now, yet everyone on fb has all the answers already. This one I like because of the supposed number of breedings. Condescending statements and nothing to show for it.

    (i've been lurking this thread since the beginning, pardon my sudden appearance)
    but oh my goodness, these people! where's your proof? where's the photos and documentation? where's the darn snakes!?!? you'd think a clutch of a Spider x Spider pairing would be well documented by a breeder, let alone a thriving Super Spider! it's honestly amazing that this debate is still going on.
    truly, SMH
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1