» Site Navigation
0 members and 1,604 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Fun hybrid question
Don't respond to this just to hate on hybrids. I don't care if you don't like them. I like them. But anyway, this has been confusing me for a few days. Ok, lets start.
So you breed a woma and ball python (I won't be doing this. Just wondering). It's 50% ball and 50% woma right? So then you breed it to a woma again. So then it's 75% woma and 25% ball right? But THEN, what if you breed it back to a ball? What is it? Then with that snake, what if you bread it to a half woma half ball again?
-
-
A 75/25 bred back to a ball would give you a 37.5/62.5
And breeding that back to a 50/50 would give you a 43.75/56.25
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Attempting to breed a ball python to a woma would likely end in 1 less ball python and one happy woma. Aside from that the above is correct.
1.0 Albino Black Pastel Pinstripe BP "Menolo"
0.1 Albino Spider BP "Ginger"
0.1 Black Pastel Het. Albino "Jasmine"
1.0 Woma python "Stitch"
0.1 Woma python "Milo"
0.1 Woma python "Millie"
1.0 Blackhead Python
0.1 Blackhead Python
0.1 Blackhead Python
1.0 Black South African Boerboel "Midas"
0.1 Chocolate Lab "Coco"
-
-
wait, what? I've never heard of this. Would it be genetically possible excluding the fact that the woma might eat the BP?
1.0 Normal BP
1.0 Mainland Reticulated
1.0 High lines Red Tail Boa
-
-
Re: Fun hybrid question
 Originally Posted by dylan815
wait, what? I've never heard of this. Would it be genetically possible excluding the fact that the woma might eat the BP?
I am not an expert in hybrids but I would guess womas and ball pythons are too different. I believe this question was entirely hypothetical.
1.0 Albino Black Pastel Pinstripe BP "Menolo"
0.1 Albino Spider BP "Ginger"
0.1 Black Pastel Het. Albino "Jasmine"
1.0 Woma python "Stitch"
0.1 Woma python "Milo"
0.1 Woma python "Millie"
1.0 Blackhead Python
0.1 Blackhead Python
0.1 Blackhead Python
1.0 Black South African Boerboel "Midas"
0.1 Chocolate Lab "Coco"
-
-
Re: Fun hybrid question
 Originally Posted by enginee837
I am not an expert in hybrids but I would guess womas and ball pythons are too different. I believe this question was entirely hypothetical.
Okay, thanks. I assumed this wasn't really a thing, but I was just making sure.
1.0 Normal BP
1.0 Mainland Reticulated
1.0 High lines Red Tail Boa
-
-
Re: Fun hybrid question
 Originally Posted by enginee837
Attempting to breed a ball python to a woma would likely end in 1 less ball python and one happy woma. Aside from that the above is correct.
Well considering woma/balls already exist, it seems some people made it happen without issue. here a thread with a picture of one https://ball-pythons.net/forums/show...n-hybrid-cross
from what ive been told, any python theoretically should be able to breed with any python and any boa theoretically should be able to breed with any boa. However I doubt we will see any sand boa anaconda hybrids any time soon and it might be a challenge getting a ball and a gtp to breed. So physical limitation can still apply.
Last edited by OhhWatALoser; 09-05-2017 at 11:00 AM.
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
Craiga 01453 (09-06-2017)
-
Re: Fun hybrid question
 Originally Posted by OhhWatALoser
Well considering woma/balls already exist, it seems some people made it happen without issue. here a thread with a picture of one https://ball-pythons.net/forums/show...n-hybrid-cross
from what ive been told, any python theoretically should be able to breed with any python and any boa theoretically should be able to breed with any boa. However I doubt we will see any sand boa anaconda hybrids any time soon and it might be a challenge getting a ball and a gtp to breed. So physical limitation can still apply.
That things funky lol. I guess if there is a will, then there is a way.
1.0 Normal BP
1.0 Mainland Reticulated
1.0 High lines Red Tail Boa
-
-
There you go, I stand corrected.
1.0 Albino Black Pastel Pinstripe BP "Menolo"
0.1 Albino Spider BP "Ginger"
0.1 Black Pastel Het. Albino "Jasmine"
1.0 Woma python "Stitch"
0.1 Woma python "Milo"
0.1 Woma python "Millie"
1.0 Blackhead Python
0.1 Blackhead Python
0.1 Blackhead Python
1.0 Black South African Boerboel "Midas"
0.1 Chocolate Lab "Coco"
-
-
They're called "walls" (woma+ball) and aren't too common but are out there, $600-$1000 range last I heard.
-
The Following User Says Thank You to hollowlaughter For This Useful Post:
Craiga 01453 (09-06-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|