Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,382

0 members and 1,382 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 17

Threaded View

  1. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Questions About Producing Super Ball Hybrids

    Quote Originally Posted by Aedryan Methyus View Post
    What if an albino Ball was crossed with an Albino Blood? Also, what if the Ball and Blood were both only Het Albino? Could they still produce Albino offspring?
    Quote Originally Posted by AbsoluteApril View Post
    Bloods have T+ and T- versions of albino. Assuming neither is compatible with the albino gene in BP...

    ...Only if the albino genetics were the same in both species; both carried the compatible albino gene on the same locus. I assume they would not.

    If I may... You make some assumptions April that are a little too overgeneralized. There is actually a decent likelihood of compatibility in Albino mutations as there are only a few genes that can be mutated to get the phenotype. So it is entirely possible to get an Albino hybrid in the F1 breeding. And very specifically, if you are breeding T-neg Albinos from both species together you are absolutely guaranteed to get Albino hybrids. This was done with BurmBalls, a het Albino burm was bred to a het Albino ball and generated a visual. I have also heard a rumour that someone has made an Albino Carpall from a visual x het cross.

    The "grey" areas here would arise in situations where you have T-pos Albino types that are so extreme as to appear T-neg, like the Kahl and Sharpe boas you mentioned or the three different "white"-type Albinos in retics. If you were to breed one of these to a true T-neg you would not get a visual
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 5 Users Say Thank You to asplundii For This Useful Post:

    AbsoluteApril (08-11-2017),Aedryan Methyus (08-11-2017),Craiga 01453 (08-15-2017),JodanOrNoDan (08-11-2017),paulh (08-11-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1