Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,143

0 members and 1,143 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,708
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Results 1 to 10 of 33

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Known Genetic Defects?

    Quote Originally Posted by JodanOrNoDan View Post
    I think statistically however we can say a viable (hobby terms) Super Spider, especially since we now know the mutation acts like a co-dom, has not and will not be produced.
    Oh, SuperSpiders have been produced... As dead white things. There are even a few pics floating around.


    Quote Originally Posted by BPGator View Post
    So once again, is Spider x Woma lethal?
    I have seen plenty of animals said to be SpiderWoma but I have never seen one of these animals actually breed out to be this. Most often they end up being just Spiders. And given that Woma also displays neuro issues my feeling is that, like Spider and any other neuro morph, the Spider x Woma is also lethal.


    Quote Originally Posted by BPGator View Post
    And is Woma truly dominant or in the same category as Spider where the homozygous form is lethal?
    I would say it is in the same category as SuperSpider. All the Woma x Woma clutches that I have been able to track have turned up nothing and the common denominator of neuro between the morphs it is not unreasonable to assume a similar fate for the superform
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    BPGator (07-28-2017),JodanOrNoDan (07-28-2017),OhhWatALoser (07-28-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1