Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,673

0 members and 1,673 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,060
Threads: 249,212
Posts: 2,572,741
Top Poster: JLC (31,651)
Welcome to our newest member, TillyMintz8613
Results 1 to 9 of 9

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Exact effect of Congo?

    Quote Originally Posted by BluuWolf View Post
    Is bongo and congo the same thing? I'm so confused it looks similar but I'm just not sure
    No, Congo and Bongo are not the same thing. How much did your snake cost you? Was it in the $1500-$3000 range? If not, then it is not a Bongo as Bongo is a relatively new gene and still fetches higher dollar.

    Congo is a gene that originated with Vin Russo. I suggest checking out his website for the story
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Slowcountry Balls (08-01-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1