Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,443

2 members and 1,441 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 9 of 9

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Quote Originally Posted by Tila View Post
    I am aware that fused alien heads are common. My question is what influence the more fused pattern style may have on a morph combination that already does that sort of thing, such as a black pastel mojave. I have read that only certain aspects of morphs are directly heritable and the rest appears due to chance but I was hoping someone with a similar appearing snake might have bred theirs and would be willing to share the outcome. I enjoy using the morph calculator but it is limited. It would be cool if they added a feature where you could choose things like "reduced pattern x" or "high expression x" to try out in pairings.
    While it all comes down to genetics of some sort, it is a matter of do the right random combination of genes that, in combination, affect the outcome to give you the phenotype you are looking for. With SuperBlk complex animals, the het BluEl genes and the Pied allele seem to push toward a greater occurrence of fused alien heads. Flip side, fused alien heads does not necessarily mean that there is a het BluEL or a Pied allele in the mix, it could just be some random other gene(s) interacting with the SuperBlk gene. Now, you could certainly selectively breed to maintain that phenotype, enriching for the presence of the other random gene(s), but once outside of your collection there is no guarantee the phenotype will be perpetuated because others might not maintain the level of selective breeding you would have.


    Quote Originally Posted by Tila View Post
    Tgatcccgtcactataggatcgtaactaccatgtccgtttaattggagtactg. By the way, asplundii, I complemented your footnote. Forgive me, it was pretty base.
    Not sure what you were trying to say… I translated your sequence (in all three frames) and I did not come up with any coherent “words”. And a BLAST was equally uninformative…
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Tila (07-05-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1