Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 332

0 members and 332 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,083
Threads: 249,223
Posts: 2,572,821
Top Poster: JLC (31,651)
Welcome to our newest member, Morphology
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 34

Thread: Spider breeding

  1. #21
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider breeding

    Quote Originally Posted by DLena View Post
    My position is this (and it's a big bone of contention, and I'm not trying to start WW III): I will not knowingly breed snakes that will result in the deaths of the babies - in or out of the shell - or in the creation of physically deformed or neurologically impaired babies. Enough happens accidentally. I know there are beautiful spiders and spider combos and champagnes, and HGW... but I don't think, now that we are fully aware of the situation, that they should be bred just because we like how they look.
    This mentality is why we have German shepards that can't walk properly because of their hips, Collies that can't see, Pugs that can only birth their babies by C-section and those babies need nasal surgery so they can breathe properly.
    As breeders, creating morphs and breeds for our own pleasure, it is inherently our obligation to do right by these "man made" creatures.
    And I see it in black and white, no gray. "Well it's just a little wobble." Or "But it eats, sleeps and goes to the bathroom just fine." Is fine if it's accidental. I have a baby AHS with a kink that will never be bred but wasn't bad enough to be fed off. BUT to intentionally breed knowing the bad outcome is ethically wrong for me.
    You are back peddling what you orginally said. There is no suffering we know of, there is nothing post hatch problems you speak of in 2 posts. It's a failure to thrive. There's no chance of these failure to thrive animals to effect later generations like all of the animals you list above. We can't use them to do what you imply as they fail to thrive. There is no economic gain as I show in the post above. If you find something ethically wrong with that, thats fine. Your problem however seems to be far more focused on the spider gene itself rather than the super spider that cannot do any of which you want to imply.

    I do see how there is a ethics debate, with spiders and super spiders, I've had that debate with myself. But If you want to have a discussion with substance let's at least stick to things that are true.

  2. #22
    BPnet Veteran
    Join Date
    12-16-2015
    Location
    Illinois
    Posts
    488
    Thanks
    90
    Thanked 160 Times in 103 Posts
    Images: 2

    Interesting

    I didn't know this would go there. Personally I have an issue with people saying spiders have a defect. I don't find them defective in any manner. Actually like the way the move. Is it different, yup. Does that mean it is negative, IMO no. It's different, that's all I have ever seen with them. Yeah they are quirky and weird, but that's why I like the gene. I have never seen one so bad that it doesn't thrive on its own. Heck, I have three that have the spider gene, all with different wobbles and they all eat, sleep, handle, and poop better than any of the mojavies, butters, or phantoms I have. Ok one of my phantoms eats better, but he is just a pig. I actually see the wobble as a
    good alarm. If they are wobbling bad, they are stressed. Wish all
    my snakes could tell me when they are stressed. Ethical decisions are each of ours to make on this topic. Am I shooting for a super spider, no way, I just was thinking of putting the banana with the only female that hasn't gone for me
    this year. Will I? Who knows, it all depends on how my other males do with her I guess.

  3. #23
    BPnet Veteran
    Join Date
    07-31-2016
    Location
    Kenmore NY USA
    Posts
    928
    Thanks
    434
    Thanked 380 Times in 273 Posts
    Images: 5
    I'm not a snake expert; I'm working off of what I learned from OWAL Morph Issues, several articles and books, Herp Society speakers, and affected snakes that I have seen.
    I don't believe I backpedaled (?). I originally made a quick post, then I made a deeper post trying to articulate my personal pov with extrapolated examples of man-made wrongs (my opinion).
    Something I am extremely well versed in...collies and their eye anomaly. It took many generations of breeding to "fix" the elongated snout and lack of "stop" at the eye that was desired, into the breed, and it wasn't until the AKC standard was set, that people realized/acknowledged that breeding for these particular characteristics caused a shift in eye placement, shape and size that was detrimental to eye function.
    Does it cause pain? No. Can the animal still eat, sleep, poop, breed? Definitely. Does the dog know any different? No. Those facts don't make the continued breeding of affected dogs okay (for me).
    At what point do we decide the wobble is too much? Or the duckbill? Or the bulgy or tiny eyes? How many generations will it take before the the "little issue" becomes indicative of a deeper problem (if it ever will)?
    The first BP I bought was an albino female, and a champagne male came with her. His wobble is bad whenever he tries to interact with anything...being held, climbing, feeding time. Does he know any different? I don't imagine he does. He has thrived (eats, sleeps, poops, grows). He doesn't act like he is in pain.
    But I cringe when it's time to feed him because he can't strike and hit his ft rat to save his life. I feel really bad when his head is wobbling all over.
    I didn't intend to have untruths in anything I said. I'm trying to articulate how I view breeding and our obligation to the animals we are choosing to create.
    The OP asked for opinions while mulling over breeding plans. I gave the OP my opinion. The OP's statements were contradictory (hence I considered them to be mullings). The OP seemed to be saying: I've researched the pairing and found this concern about it, but these are the snakes I have, and this is what I want to get, so I'm probably going to breed them anyway.
    I realize this is long. I'm not trying to be a jerk or cause upset. This issue/mindset is a very tender spot for me. I responded emotionally.
    Take care.

  4. The Following 2 Users Say Thank You to DLena For This Useful Post:

    Crowfingers (06-21-2017),Kira (06-20-2017)

  5. #24
    BPnet Veteran
    Join Date
    07-31-2016
    Location
    Kenmore NY USA
    Posts
    928
    Thanks
    434
    Thanked 380 Times in 273 Posts
    Images: 5
    And failure to thrive is indicative of a problem. Doesn't that mean they don't eat well or grow properly and they die? That happens to human babies as well. It's a terrible thing. I know they're just snakes, but they're living beings. They aren't just acceptable losses to me.

  6. The Following User Says Thank You to DLena For This Useful Post:

    Kira (06-20-2017)

  7. #25
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider breeding

    Quote Originally Posted by DLena View Post
    And failure to thrive is indicative of a problem. Doesn't that mean they don't eat well or grow properly and they die? That happens to human babies as well. It's a terrible thing. I know they're just snakes, but they're living beings. They aren't just acceptable losses to me.
    Not a single super spider has gone full term, they don't hatch, so how could they eat? With everything you are saying you seem to be very misinformed about what actually happens. I would suggest you look into the facts first then form an opinion. I'm not saying there isn't an ethics debate, but you still need correct facts to discuss it.

  8. #26
    BPnet Veteran
    Join Date
    12-16-2015
    Location
    Illinois
    Posts
    488
    Thanks
    90
    Thanked 160 Times in 103 Posts
    Images: 2

    Debate

    I almost just submitted this long reply about the ethics of breeding, but that really got off the point. Here is what I was really wondering, I always heard the pairing of two spiders was lethal. Had I researched it much when I submitted the post? Not really. My concern really was for the eggs that didn't end up with the double spider genes. Well, after reading some and discussions here, I realize they would be fine. I would have a 25% on average failure of eggs. Ok, that might be ok with me, as my whole breeding project really has very little to due with money or numbers I produce. I bred snakes for money 25 years ago, and actually got out to go to college. Now a few years back my daughter wanted a pet snake. When I saw what has happened with ball pythons in the past 25 years I was amazed. I mean look at the animals that are being produced, they look amazing! This breeding "project" I am helping my daughter with is more a life lesson on working hard to produce what she wants. Right now she is shooting for bels, purple passions, any mystic potions. Will she get one? I am hoping. For me I get the the pride of seeing her enjoy doing this and "funding" her project. She, at 12, knows more about genetics than I do, can identify all the different more better, and truly does care about the animals and who the ones she produces goes to. Will she make money with them?, who knows but as long as she is learning I love to see a kid working with animal instead of sitting on some video game all day. We have discussed the spider pairing and she is on the fence about the pairing, as am I. To her it is about the ethical debate, to me it's more about what we get out of a clutch to keep as hold backs. I really like the banana combos and I think that's one way we are headed, but this is all her projects so we will see what she decided.

    Thanks everyone for taking the time to reply.

  9. #27
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spider breeding

    Quote Originally Posted by Bcycling View Post
    If I currently want to produce spider bananas my only real option is to pair my male spider banana to my female spider. Will I do it?
    This is a completely untrue statement.

    If you want to produce more Banana Spiders then you can breed your male Banana Spider to any female and you have 1:4 odds of producing another Banana Spider. No different than breeding a Bumblebee or a Mochi or a PastelYB.


    Quote Originally Posted by OhhWatALoser View Post
    Not a single super spider has gone full term, they don't hatch
    I know of four cases where SuperSpiders have left the egg (some of those may have been cut by the breeder, I never asked that detail) and I have rumors of three others that I have not been able to confirm. So they do, on very rare occasion, go full term. That said, every single one has died within hours.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    DLena (06-20-2017),Kira (06-20-2017)

  11. #28
    BPnet Veteran
    Join Date
    12-16-2015
    Location
    Illinois
    Posts
    488
    Thanks
    90
    Thanked 160 Times in 103 Posts
    Images: 2

    Re: Spider breeding

    For me that statement was true. All my other females are unable to breed at this point, so for me it is true. Next season it will be differnt, but for now it is true.

  12. #29
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77
    I can see I am somewhere in between on this one. I will and do breed spiders. I like them. I have not and do not intend to breed spider to spider. I will never say never but I am avoiding it. I do not like creating non-viable babies. I do not like creating babies that cannot be sold. Guaranteed dead falls into cannot be sold. I do not mess with any combination that has a higher than average rate of producing defective animals. A defective animal just worsens your odds of getting what you want out of the breeding. Say you have a 1/16 of getting what you want and then you add the potential defect, what happens to your odds?

    Everyone has their own ethical line. What they can live with they do. It is not my place to judge. What I do believe to be true though is that you are playing a numbers game and whether you are chasing a specific morph or you trying to make a little cash on the side, spider to spider just is not the way to go unless there is another must have gene lurking in there. The better option is to plan your pairings so that the whole problem is avoided in the first place.

  13. #30
    BPnet Veteran
    Join Date
    07-31-2016
    Location
    Kenmore NY USA
    Posts
    928
    Thanks
    434
    Thanked 380 Times in 273 Posts
    Images: 5

    Re: Spider breeding

    Quote Originally Posted by OhhWatALoser View Post
    Not a single super spider has gone full term, they don't hatch, so how could they eat? With everything you are saying you seem to be very misinformed about what actually happens. I would suggest you look into the facts first then form an opinion. I'm not saying there isn't an ethics debate, but you still need correct facts to discuss it.
    I don't see where I ever specifically mentioned spider x spider. I am talking about any known pairing that routinely produces deformed offspring. My facts are accurate. I'm sorry that my presentation of them was too "rough draft" and created your misunderstanding.



    I know of four cases where SuperSpiders have left the egg (some of those may have been cut by the breeder, I never asked that detail) and I have rumors of three others that I have not been able to confirm. So they do, on very rare occasion, go full term. That said, every single one has died within hours.

    ...thank you.

    For me that statement was true. All my other females are unable to breed at this point, so for me it is true. Next season it will be differnt, but for now it is true.

    ...the ability to delay gratification is also a very important life lesson. What harm would there be to waiting until next year, when you could do a different pairing?

    respectfully submitted,
    Darlene

  14. The Following User Says Thank You to DLena For This Useful Post:

    Kira (06-20-2017)

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1