» Site Navigation
2 members and 731 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,112
Posts: 2,572,161
Top Poster: JLC (31,651)
|
-
Has anybody seen the triple caramel?
I had just came across a website with lots of morphs lol not wobp but another and near the bottom their was a triple caramel albino which had vpi/nerd as their the same apparently but their was that bhb and tsk I'd post the pic but I'm not aloud and idk if I can post the link so I rather not to be safe but if anybody else has seen it or made 1 can you show me some pics hopefully an adult I seen the supposed baby
Sent from my SM-G920W8 using Tapatalk
-
The Following User Says Thank You to Ballpythonguy92 For This Useful Post:
spellbound04 (06-09-2017)
-
You can share the link to the pic, I hope you do because I'd be interested in seeing this.
I love caramels
-
-
-
The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:
AbsoluteApril (06-09-2017),C.Marie (06-09-2017)
-
ahhh so it's just a regular caramel, with the caramel genes inherited from 3 of the different lines. thanks for finding the photo Deborah!
-
The Following User Says Thank You to AbsoluteApril For This Useful Post:
-
Re: Has anybody seen the triple caramel?
 Originally Posted by AbsoluteApril
ahhh so it's just a regular caramel, with the caramel genes inherited from 3 of the different lines.
Except there are only 2 copies of the Caramel gene, because that is how genetics works, so it is not a triple anything. It is just an outcrossed Caramel.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
I said 3 different lines in the mix, I know there are only 2 copies of each gene.
-
-
Re: Has anybody seen the triple caramel?
Thank you that explains alot and what I was originally thinking as I've heard of out crosses of bhb and vpi but then was confused when I seen the triple as they made it sound like they just bred a caramel to caramel then raised one up and bred to another line but makes way more sense thanks and I'll go find it it's a weird page and has some morphs that are unproven as of yet and ones it says unknown but are now known
Sent from my SM-G920W8 using Tapatalk
-
-
Re: Has anybody seen the triple caramel?
 Originally Posted by Deborah
That's the one but not the site I found it on
Sent from my SM-G920W8 using Tapatalk
-
-
Re: Has anybody seen the triple caramel?
-
-
Re: Has anybody seen the triple caramel?
Apparently that animal was produced in 2009 not much info on how it was produced.
I wonder if all those lines were really ever proven to be incompatible. (Long time ago and I never work with Caramel for obvious reason)
Last edited by Stewart_Reptiles; 06-12-2017 at 05:21 PM.
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|