» Site Navigation
1 members and 1,029 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,083
Threads: 249,222
Posts: 2,572,819
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Inbreeding. Is it ok with snakes?
So this year we are hoping to have a few successful clutches with some hold backs. What is the opinion on inbreeding balls with parents and siblings? I know it happens a lot, but are there negative outcomes? I would rather abound doing it, but am wondering if anyone else really thinks much about it within the breeding community?
-
-
Cold blooded animals are very different from warm blooded animals, so line breeding is fine of course it's only fine if you have genetically sound animals, common sense would tell you that is some animals with issues are produced you would not want to line breed those specific animals.
And here is a good read https://ball-pythons.net/forums/show...ght=inbreeding
-
The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:
Oxylepy (05-26-2017),Vipera Berus (05-29-2017)
-
Re: Inbreeding. Is it ok with snakes?
Yes it is. There are no issues or negative outcomes. Many breeders will breed a son back to the mother to try to prove out a gene. I personally just bred siblings together.
Sent from my SM-N920V using Tapatalk
1.0 POG…. Surak 1.0 Calico……Caius 1.0 Cinnamon….Jerath 1.0 Enchi…..Xavier
1.0 Leopard 100% het pied……Aslan 1.0 Black pastel 100% het pied…..Teal’C 1.0 Pied….Apollo
1.0 Albino….Draco 1.0 Yellowbelly 100% Albino……Aragorn 1.0 Mystic......Morpheus 1.0 Hidden gene woma specter.....Mulder 1.0 Fire.....Theseus 1.0 Champagne pinstripe.....Hades 1.0 Banana bumblebee.......Zeus 1.0 Lesser.....Anders 1.0 Desert.......Jaba
0.1 Normal 100% het hypo….Sarabi 0.1 Lesser…..Kara 0.1 Pinstripe…..Tehla 0.1 Spider….Charlotte
0.1 Yellowbelly 100% het albino…..Arwen 0.1 Enchi…….Jean 0.1 Black pastel 100% het pied…..Ishta
0.1 GHI……Sena 0.1 pastel........Athena 0.1 normal......Willow 0.1 Ghost.....Persephone 0.1 Lemonblast 100% hypo.....Luna 0.1 Orange dream yellowbelly....Scully 0.1 100% het pied......Daphne 0.1 Mojave.......Trinity 0.1 100% het albino......Astoria 0.1 Black pastel.....Boomer
-
-
I wouldn't say there are NO negative issues. One of the first signs you're likely to notice that a line has been too inbred is a drop in fertility, and viability of clutches. However, in the wild isolated population generally interbreed without issue, which is how you end up with localities. It's a good idea to out cross every so often even if you're trying to line breed to maintain genetic viability and diversity.
-
The Following User Says Thank You to Lizardlicks For This Useful Post:
-
You can definitely line breed, in fact you can end up selectively breeding to produce lines of snakes, displaying specific traits somewhat unique to the line. Often a few generations of outbreeding will get rid of these traits.
Line breeding can also create morphs by isolating certain genes in the lineage, when a mutation occurs genetically you can seemingly have a spontaneous morph appear and can be line bred to prove out the morph. There are a lot of positives to line breeding.
Sometimes, however, you may be perpetuating unhealthy traits, such as neurological disorders. It is important to selectively breed for this reason, removing genetics which are causing issues, and continuing desirable ones.
In other words, breeding is eugenics for kids!
All that said, Lizardlicks is correct, you want to outbreed from time to time.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Re: Inbreeding. Is it ok with snakes?
Okay, I am going to buck the system a little here...
 Originally Posted by Deborah
Cold blooded animals are very different from warm blooded animals,
"Bloodedness" has nothing to do with susceptibility/resistance to inbreeding. Inbreeding is about genetics and the genetics of snakes is no different than the genetics of dog. Genetics is genetics is genetics.
 Originally Posted by Lizardlicks
However, in the wild isolated population generally interbreed without issue,
No, no they do not. This is a flawed argument that is used to justify inbreeding in captivity. Wild populations are not commonly inbreeding unless they are genetically isolate (island populations, geographic trap, etc.)
I had a very long explanation of this on another forum but, unfortunately, that forum is no longer accessible. The short version though is that no animal is so sedentary that it and its offspring are likely to frequently encounter one another.
Ball pythons can, and do, travel around. Especially males and especially during the breeding season. I cannot remember the exact back of envelope calculations in my old post but if you assume 1.1 survivors from a given clutch reach adulthood to breed and account for just a fraction of the potential travel of that 1.1 and both of their parents then you end up with something like an estimated 5-15km of distance between any possible pairing of sibling/parent. So the actual likelihood of inbreeding it much lower in the wild than people claim.
 Originally Posted by Deborah
so line breeding is fine of course it's only fine if you have genetically sound animals, common sense would tell you that is some animals with issues are produced you would not want to line breed those specific animals.
This, however, I can support. However, take note that the bolded part is the catch... How do you know your animals are 100% genetically sound??
Now, with all of that said... Can you inbreed? Sure. Can it cause problems? Absolutely. Will those problems necessarily show up immediately? No. Will they show up eventually? Most likely. As long as you are fully aware of all of these points then you can make the decision as to whether you want to inbreed or not. Personally, I do not see 1-2 generations of inbreeding being too terrible, but if I can avoid them by outcrossing (like by buying an unrelated mate of the same morph) then I am going to opt for outcrossing every time.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
Dumdum333 (05-26-2017),kxr (05-31-2017),Linkin (05-26-2017),Oxylepy (05-26-2017)
-
Re: Inbreeding. Is it ok with snakes?
 Originally Posted by asplundii
Now, with all of that said... Can you inbreed? Sure. Can it cause problems? Absolutely. Will those problems necessarily show up immediately? No. Will they show up eventually? Most likely. As long as you are fully aware of all of these points then you can make the decision as to whether you want to inbreed or not. Personally, I do not see 1-2 generations of inbreeding being too terrible, but if I can avoid them by outcrossing (like by buying an unrelated mate of the same morph) then I am going to opt for outcrossing every time.
And here is the catch, a lot of morphs Spider, Pinstripe, for example they only ever found one in the wild. so every single spider is related and every single pinstripe is related, clown, sunset and almost every single recessive gene they end up with one wild caught so they are all related. so the only way to produce more of the gene is you have to inbreed. there is no unrelated mate in most cases.
Last edited by StillBP; 05-26-2017 at 06:11 PM.
Laziness is nothing more than the habit of resting before you get tired.
-
The Following User Says Thank You to StillBP For This Useful Post:
-
Re: Inbreeding. Is it ok with snakes?
 Originally Posted by StillBP
And here is the catch, a lot of morphs Spider, Pinstripe, for example they only ever found one in the wild. so every single spider is related and every single pinstripe is related, clown, sunset and almost every single recessive gene they end up with one wild caught so they are all related. so the only way to produce more of the gene is you have to inbreed. there is no unrelated mate in most cases.
You are missing the point of what I was saying. The way this hobby works, yes, early on there will likely be a higher level of inbreeding as you try to replicate the phenotype, even then, you can rapidly hit a point where breeding two animals with very little co-relation is possible and once you reach that point then unrelated breedings are relatively easy. However, the way this hobby does it is certainly not "the only way". If I were to take a male of a new morph I could breed it to two unrelated females, A and B. Then I could take the males from those clutches and breed each of them to two unrelated females. Repeat. Repeat. Repeat. Repeat. Now, if I take one of the visual males from the far end of the B branch and breed it to a visual female from the first breeding on the A branch then the degree of relatedness would be ~1.5%. As you can see then, it is very possible to do it without inbreeding, it is just time consuming and that is something this hobby has very little patience for. So yes, while every single Spider is in some way related to the original founder animal, in the current market, because there has been such a huge amount of out breeding on this morph done, we are now at a point that if you were to, say, randomly select any two Spider animals from a show then quite literally the only gene those two animals will share is the Spider allele.
Last edited by asplundii; 05-30-2017 at 09:29 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Inbreeding. Is it ok with snakes?
 Originally Posted by asplundii
You are missing the point of what I was saying. The way this hobby works, yes, early on there will likely be a higher level of inbreeding as you try to replicate the phenotype, even then, you can rapidly hit a point where breeding two animals with very little co-relation is possible and once you reach that point then unrelated breedings are relatively easy. However, the way this hobby does it is certainly not "the only way". If I were to take a male of a new morph I could breed it to two unrelated females, A and B. Then I could take the males from those clutches and breed each of them to two unrelated females. Repeat. Repeat. Repeat. Repeat. Now, if I take one of the visual males from the far end of the B branch and breed it to a visual female from the first breeding on the A branch then the degree of relatedness would be ~1.5%. As you can see then, it is very possible to do it without inbreeding, it is just time consuming and that is something this hobby has very little patience for. So yes, while every single Spider is in some way related to the original founder animal, in the current market, because there has been such a huge amount of out breeding on this morph done, we are now at a point that if you were to, say, randomly select any two Spider animals from a show then quite literally the only gene those two animals will share is the Spider allele.
No I get the point. My point was that in breeding is inbreeding. No matter if it's 3rd cousins twice removed or father daughter. And almost every morph is inbred. Nothing can be done about it.
Sent from my Z981 using Tapatalk
Laziness is nothing more than the habit of resting before you get tired.
-
-
Re: Inbreeding. Is it ok with snakes?
 Originally Posted by StillBP
No I get the point. My point was that in breeding is inbreeding. No matter if it's 3rd cousins twice removed or father daughter. And almost every morph is inbred. Nothing can be done about it.
By your logic then every person on the planet that has a child is practicing inbreeding...
Inbreeding is not breeding together two individuals that at some distant point shared a common ancestor. Inbreeding is the act of breeding genetically closely related individuals together, especially over multiple generations. So yes, it does matter if it is father to daughter versus third cousins twice removed because the prior constitutes two individuals that are genetically closely related and therefore is inbreeding whereas the latter, depending on the actual genetic relatedness, are quite likely not genetically closely related and so could be considered outbreed. And two random animals with a SCA over twenty generations in the past are most certainly not genetically related in any appreciable manner and it would be ridiculous to claim that breeding those two animals together constitutes inbreeding.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
kxr (05-31-2017),Linkin (06-06-2017),Lizardlicks (05-31-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|