Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 509

1 members and 508 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,083
Threads: 249,222
Posts: 2,572,819
Top Poster: JLC (31,651)
Welcome to our newest member, Morphology
Results 1 to 10 of 11

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Inbreeding. Is it ok with snakes?

    Quote Originally Posted by StillBP View Post
    No I get the point. My point was that in breeding is inbreeding. No matter if it's 3rd cousins twice removed or father daughter. And almost every morph is inbred. Nothing can be done about it.
    By your logic then every person on the planet that has a child is practicing inbreeding...

    Inbreeding is not breeding together two individuals that at some distant point shared a common ancestor. Inbreeding is the act of breeding genetically closely related individuals together, especially over multiple generations. So yes, it does matter if it is father to daughter versus third cousins twice removed because the prior constitutes two individuals that are genetically closely related and therefore is inbreeding whereas the latter, depending on the actual genetic relatedness, are quite likely not genetically closely related and so could be considered outbreed. And two random animals with a SCA over twenty generations in the past are most certainly not genetically related in any appreciable manner and it would be ridiculous to claim that breeding those two animals together constitutes inbreeding.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    kxr (05-31-2017),Linkin (06-06-2017),Lizardlicks (05-31-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1