» Site Navigation
0 members and 585 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,190
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
 Originally Posted by JodanOrNoDan
Just an additional comment. I have not seen a ball yet that I consider a true black. There are balls that have true black in their pattern but not covering the entire body. Once again, lesser /mojave and lesser/ lesser are white. The other bell complex animals often have a yellowish hue and or have some yellow dorsal striping. The white of the white will be an albino lesser/mojave but this will of course have red eyes.
The black eyed white snakes are hit and miss with the total amount of pure white. I have an Ivory that is more white than my super mojave but I have seen plenty of Ivories with quite a bit of pigment. I have seen very white super fires but it is not odd to have orange on those animals as well.
Is this black enough for you? 
http://www.worldofballpythons.com/mo...uper-mahogany/
I really like that one myself. I can see quite a bit of potential there if they are all consistently that dark and maintain that into adulthood.
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to kxr For This Useful Post:
JodanOrNoDan (04-24-2017)
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
 Originally Posted by kxr
Yeah, it's pretty black, and there is probably potential if line breeding with that animal could be done without defects. I'd love to see if it manages to keep its color.
-
-
Have you looked at some axanthics? maybe some 2 genes? I think a lot of them have the blacks/greys you're looking for, and I'm sure in your price range.
I love axanthics, will definitely be looking that direction for my next BP.
-
-
GHI Lessers are nice too
I would love to get one of those after I leave college.
Snakes:
~Ball Pythons: 1.0 Spider (Corkii) --- 1.0 Mojave (Meeko) --- 1.0 Bumblebelly (Pringle) --- 0.1 Normal (Fraggles) --- 0.1 Lesser Enchi (Khaleesi) --- 1.0 Pied (Piper)
~Cornsnakes: 0.1 Tessera.het Amel Motley (Twiglet) --- 1.0 Amel (Wotsit)
~Hognose: 0.0.1 Normal.66%hetAlbino (Waffle)
~Boa: 0.1 Normal (Medusa)
~Spotted Python 0.1 (Unnamed)
~Bredlis Python 0.1 (Unnamed)
~Burmese Python: 0.1 Granite (Skittles)
Lizards:
~Crested Geckos: 1.0 Buckskin Dalmatian (Rex) --- 0.1 Orange Dalmatian (Apollo) --- 1.1 Harlequin (Cosmos / Nova) --- 1.0 Extreme Harlequin (Dino) --- 1.1 Halloween Partial Pin (Pumpkin/Unnamed) --- 1.0 Red and Cream partial pin (unnamed)
~Leopard Gecko: 1.0 Hypo (Dave)
~Bearded Dragon: 0.1 Red Leatherback.hetTrans
~Ackie Monitor: 0.0.1 (Unnamed)
~Jewled Lecarta 1.0 (Wizard)
Others:
Tortoise, Dog, Tarantulas, Parrot
-
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
What would an axanthic super mahogany come out like? Xx
Sent from my iPhone using Tapatalk
-
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
 Originally Posted by RoflOnMyWaffle
Thank you, he is lovely  Just not quite white enough, I'm talking like paper white hahaha but I see what you mean, almost NO yellow
I will see if I can get a pic of my holdback female this evening (assuming she is not in shed). She is hands down the cleanest white ball I have seen
 Originally Posted by JodanOrNoDan
Once again, lesser /mojave and lesser/ lesser are white. The other bell complex animals often have a yellowish hue and or have some yellow dorsal striping.
I am just curious, not specifically to you Dan, but to everyone saying that Lesser/Mojave and SuperLesser are the whitest leucistics out there, have any of you ever seen an adult of these? Every adult "white" BluEL I have seen has had a yellowish tint to it and often a discernible yellow dorsal stripe... This includes SuperLesser, Lesser/Mojave and Lesser/Russo. Whereas the couple white adult BlkELs (and even the white on adult BlkELs with coloured patches) have been very pure and clean.
 Originally Posted by JodanOrNoDan
The black eyed white snakes are hit and miss with the total amount of pure white.
This seems to depend on the lineage. Most Fires seem to be hit or miss on throwing coloured patches but Lemonbacks seem to throw all whites frequently. And Albey's Sauce line seems to do the same.
 Originally Posted by JodanOrNoDan
I have an Ivory that is more white than my super mojave but I have seen plenty of Ivories with quite a bit of pigment.
This is another direction I did not think of... I had an Ivory Butter Pastel that was pretty white. He had a faint ghost of a pattern if you caught him in the right light but for the most he was clean. My suspicion is that it was the Butter in him that cleaned him up.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
"I am just curious, not specifically to you Dan, but to everyone saying that Lesser/Mojave and SuperLesser are the whitest leucistics out there, have any of you ever seen an adult of these? Every adult "white" BluEL I have seen has had a yellowish tint to it and often a discernible yellow dorsal stripe... This includes SuperLesser, Lesser/Mojave and Lesser/Russo. Whereas the couple white adult BlkELs (and even the white on adult BlkELs with coloured patches) have been very pure and clean."
................................................................................ .................................
I currently have three adult white breeders. A Spider Super Mojave, a Lesser/Mojave, and an Ivory. I have had them since they were a year or less old and their color has not changed. The Super Mojave's degree of white changes according to where he is in his shed cycle. He get's "dirty" when close to shedding. The other two do not. My purple passions do not get "dirty" either.
As to Super Fires, I do not disagree. This is a line breeding issue that can be pushed one way or another over generations.
Last edited by JodanOrNoDan; 04-25-2017 at 09:54 AM.
-
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
So is there a holy grail of WHITE Royals/Balls ???
-
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
 Originally Posted by Zincubus
So is there a holy grail of WHITE Royals/Balls ???
In my world there is. It's called a Cherry Bomb.
-
-
Re: Help me find a morph! - Blacks/greys/whites maybe?
 Originally Posted by asplundii
I am just curious, not specifically to you Dan, but to everyone saying that Lesser/Mojave and SuperLesser are the whitest leucistics out there, have any of you ever seen an adult of these? Every adult "white" BluEL I have seen has had a yellowish tint to it and often a discernible yellow dorsal stripe... This includes SuperLesser, Lesser/Mojave and Lesser/Russo. Whereas the couple white adult BlkELs (and even the white on adult BlkELs with coloured patches) have been very pure and clean.
.
I own many BEL morphs and in my experience the super lessers and lesser/mojaves are the only ones I've seen that can maintain pure white as adults. I've heard people say super russos are whitest but mine has yellow and any other one I've seen has faint yellow pattern too. I shared her in a black Light thread before I can try to dig up.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|