Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 613

1 members and 612 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 1 of 2 12 LastLast
Results 1 to 10 of 17
  1. #1
    BPnet Veteran Oxylepy's Avatar
    Join Date
    10-25-2008
    Location
    Pittsburgh Pennsylvania
    Posts
    2,383
    Thanks
    362
    Thanked 573 Times in 434 Posts

    Butters and Lessers, are there distinctions?

    Alright, I am proposing this to the community as a whole, and trying to remove my own personal views from this.

    Are there distinct differences between these two morphs?

    If there are distinct differences that have held up over time seperating the lines, they must remain as they are, separate.

    If there are not distinct differences between the two morphs that have held up over time they should be condensed into a single morph.

    If there are distinct differences those differences need to be stated for identification purposes of the two lines, if those differences do not hold up to the vast majority of individuals within the line, they are not distint enough to be viewed as distinct differences.

    Can we determine that there is a distinct difference between the lines for the purpose of line identification? Or can we not?
    Ball Pythons 1.1 Lesser, Pastel
    1.0 Lesser Pastel, 0.0.7 mixed babies

  2. #2
    BPnet Lifer redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,525
    Thanks
    1,968
    Thanked 4,018 Times in 1,743 Posts
    Images: 5
    People like to think there is a difference, since "butters" are generally priced higher than lessers, but they're exactly the same. The only variation in pattern is the normal variation that occurs in any morph, and can be found in any lesser or butter animal.

    I remember there was a thread someone on the forum made awhile ago that went like "Which ones are butters and which are lessers?" to prove if anyone can tell a distinct difference between the two, since some users were insisting that there was a difference. And he posted pictures of a few of his snakes. People were guessing and debating, which one looks more "buttery" than the others... In the end, the answer was that all of them were lessers, and he doesn't even own butters. LOL
    Last edited by redshepherd; 04-18-2017 at 09:16 PM.




  3. The Following 4 Users Say Thank You to redshepherd For This Useful Post:

    Dezoruba (04-18-2017),Hannahshissyfix (04-20-2017),MushroomMang (08-14-2018),Oxylepy (04-18-2017)

  4. #3
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts
    Red that's great! I agree they're the same morph and have a few of each title that I wouldn't be able to differentiate if I hadn't labeled them as what they where purchased as.

  5. The Following 2 Users Say Thank You to Hannahshissyfix For This Useful Post:

    Matt850 (04-22-2017),Oxylepy (04-20-2017)

  6. #4
    BPnet Senior Member Lizardlicks's Avatar
    Join Date
    12-08-2014
    Location
    Spokane, WA
    Posts
    1,524
    Thanks
    814
    Thanked 1,149 Times in 657 Posts
    That seems to be the general consensus I run into; they are the same morph, but the lines have been separate for so long that it's... idk considered good form or something? To continue labeling any snakes you produce according to what line you have.

  7. The Following User Says Thank You to Lizardlicks For This Useful Post:

    Oxylepy (04-20-2017)

  8. #5
    BPnet Lifer redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,525
    Thanks
    1,968
    Thanked 4,018 Times in 1,743 Posts
    Images: 5

    Re: Butters and Lessers, are there distinctions?

    Quote Originally Posted by Lizardlicks View Post
    That seems to be the general consensus I run into; they are the same morph, but the lines have been separate for so long that it's... idk considered good form or something? To continue labeling any snakes you produce according to what line you have.
    Yeah, I also heard it's ethical to just keep going with differentiating the names. So I technically have to call my super lesser a "lesser butter", since that's what I bought him as LOL.
    Last edited by redshepherd; 04-20-2017 at 09:46 PM.




  9. The Following User Says Thank You to redshepherd For This Useful Post:

    Oxylepy (04-20-2017)

  10. #6
    BPnet Senior Member Lizardlicks's Avatar
    Join Date
    12-08-2014
    Location
    Spokane, WA
    Posts
    1,524
    Thanks
    814
    Thanked 1,149 Times in 657 Posts
    Haha, and see that's what I wonders, there are probably lot of lucies that came from a lesserxbutter pairing that then went on to make more babies. There's no way to tell what line they are, so what, do you just market it as the more expensive one?

  11. The Following User Says Thank You to Lizardlicks For This Useful Post:

    Oxylepy (04-20-2017)

  12. #7
    BPnet Veteran Oxylepy's Avatar
    Join Date
    10-25-2008
    Location
    Pittsburgh Pennsylvania
    Posts
    2,383
    Thanks
    362
    Thanked 573 Times in 434 Posts
    Red, considering you have a lesser butter, its offspring have now been muddied to the point you can no longer distinctly declare one a lesser and another a butter. Leading to an asterisk next to your animals, which can no longer clearly state a line distinction.

    While you may engage in ethical behavior by disclosing this to customers, others may decide to not do so and sell one at a higher price because the name itself holds value in someone's eyes. The end result is further confusion.
    Ball Pythons 1.1 Lesser, Pastel
    1.0 Lesser Pastel, 0.0.7 mixed babies

  13. #8
    BPnet Veteran Oxylepy's Avatar
    Join Date
    10-25-2008
    Location
    Pittsburgh Pennsylvania
    Posts
    2,383
    Thanks
    362
    Thanked 573 Times in 434 Posts

    Re: Butters and Lessers, are there distinctions?

    Quote Originally Posted by Lizardlicks View Post
    That seems to be the general consensus I run into; they are the same morph, but the lines have been separate for so long that it's... idk considered good form or something? To continue labeling any snakes you produce according to what line you have.
    If that's the general consensus of the community, perhaps we should rebrand the morph as a single thing, like with pastels, then have separate lines to offer a distinction between them for those who have been maintaining a "pure" line.

    As an example, we rebrand them Plattys, so one can have a Butter line Platty, or a Lesser line Platty. Personally I like this name because it works well with Ralph's original Platinum (Platty Daddy), and the het daddy gene.

    Then you end up with 3 options, Plattys, Butter Plattys, and Lesser Plattys. Which leads to a group for undetermined snake lines, but maintains the line distinction, as with Pastels.
    Ball Pythons 1.1 Lesser, Pastel
    1.0 Lesser Pastel, 0.0.7 mixed babies

  14. #9
    Registered User J880011's Avatar
    Join Date
    02-05-2017
    Location
    Charleston WV
    Posts
    5
    Thanks
    16
    Thanked 6 Times in 3 Posts

    Re: Butters and Lessers, are there distinctions?

    So I'm curious. Does a Butterxlesser bel run the same risks for bug eyes as a super lesser?

  15. The Following User Says Thank You to J880011 For This Useful Post:

    Oxylepy (04-21-2017)

  16. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Butters and Lessers, are there distinctions?

    Quote Originally Posted by Oxylepy View Post
    As an example, we rebrand them Plattys, so one can have a Butter line Platty, or a Lesser line Platty. Personally I like this name because it works well with Ralph's original Platinum (Platty Daddy), and the het daddy gene.
    Except people (including RDR himself) generally use Platty as shorthand for PlattyDaddy so you would have to rewrite the entire usage of that epithet throughout the hobby which is as impossible as rebranding all of them to Lesser alone or Butter alone.

    Also, rebranding the lines a la Pastel is not going to help in a case like Red's because, while there are different lines of Pastel, if you have a SuperPastel from two different lines once you breed it out I can just about guarantee you cannot ID which babies carry the allele from a specific line.

    Really, it is easier to just let people call them whatever they want to call them. Both Butter and Lesser have been around long enough that neither is worth more than the other.


    Quote Originally Posted by J880011 View Post
    So I'm curious. Does a Butterxlesser bel run the same risks for bug eyes as a super lesser?
    Yes, they do
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  17. The Following User Says Thank You to asplundii For This Useful Post:

    Oxylepy (04-21-2017)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1