Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 599

2 members and 597 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.

» Today's Birthdays

None

» Stats

Members: 75,880
Threads: 249,080
Posts: 2,572,008
Top Poster: JLC (31,651)
Welcome to our newest member, pickledratinajar
Page 4 of 5 FirstFirst 12345 LastLast
Results 31 to 40 of 50
  1. #31
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by JodanOrNoDan View Post
    I breed these combos also. I'm thinking the middle one is the 3P + enchi. the bottom is the 3p. I'm curious as to why you think otherwise?

    My logic was that Enchi enhances the expression of yellow in the BluELs and has a tendency to pull the side pattern away from the dorsal stripe.

    It is possible I am incorrect, no one had made PPEP before last season so I had nothing to compare to. But I really hope I am not wrong because I sold what I had labeled as the PPP
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #32
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by asplundii View Post
    My logic was that Enchi enhances the expression of yellow in the BluELs and has a tendency to pull the side pattern away from the dorsal stripe.

    It is possible I am incorrect, no one had made PPEP before last season so I had nothing to compare to. But I really hope I am not wrong because I sold what I had labeled as the PPP
    I think I may have thought that too in your situation if I had not already produced one without the enchi. I wish I had a better picture of this guy right now, but he is definitely PPP. There was no enchi involved in his breeding. The picture does not show the yellow dorsal very well, but it has gotten even more yellow as he has aged. Who knows? You may be right, but even the pattern seems right. It is so flipping hard to tell when the genes start adding up.



  3. #33
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts
    I'm on my phone or I'd post a picture but Leopard Mojave for the win!!
    Laziness is nothing more than the habit of resting before you get tired.

  4. The Following 2 Users Say Thank You to StillBP For This Useful Post:

    kxr (04-04-2017),tttaylorrr (04-04-2017)

  5. #34
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by StillBP View Post
    I'm on my phone or I'd post a picture but Leopard Mojave for the win!!
    EDIT: TOS VIOLATION

    http://www.worldofballpythons.com/mo...eopard-mojave/

    wow, beautiful colors! that contrast tho
    Last edited by Stewart_Reptiles; 04-04-2017 at 03:41 PM.
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  6. #35
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by StillBP View Post
    I'm on my phone or I'd post a picture but Leopard Mojave for the win!!
    I'll agree that its a nice animal but not even in the same class as a pastave highway.

  7. #36
    BPnet Veteran kxr's Avatar
    Join Date
    12-01-2014
    Location
    Ontario, Canada
    Posts
    740
    Thanks
    414
    Thanked 462 Times in 329 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by JodanOrNoDan View Post
    I'll agree that its a nice animal but not even in the same class as a pastave highway.
    Maybe stillbp disagrees or maybe they posted this simply because leopard Mojave hasn't been mentioned...

    You're also comparing a two gene animal to a four gene animal. There are some awesome combos that have been made with Mojave leopard (just a few three and one four gene animal from WOB)

    EDIT:TOS Violation


    http://www.worldofballpythons.com/mo...jave-spotnose/

    http://www.worldofballpythons.com/morphs/leopard-mochi/

    http://www.worldofballpythons.com/mo...eopard-mojave/

    http://www.worldofballpythons.com/mo...mojave-pastel/

    http://www.worldofballpythons.com/mo...ojave-special/

    Sure none of them will ever produce a super gravel but they all look awesome and will likely age better then the pastave highway.

    P.S. Sorry if I took your message out of context but I felt the need to be slightly defensive here..........


    Sent from my iPhone using Tapatalk
    Last edited by Stewart_Reptiles; 04-04-2017 at 04:15 PM.

  8. The Following 3 Users Say Thank You to kxr For This Useful Post:

    JodanOrNoDan (04-04-2017),StillBP (04-04-2017),tttaylorrr (04-04-2017)

  9. #37
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by kxr View Post
    Maybe stillbp disagrees or maybe they posted this simply because leopard Mojave hasn't been mentioned...

    You're also comparing a two gene animal to a four gene animal. There are some awesome combos that have been made with Mojave leopard (just a few three and one four gene animal from WOB)

    EDIT: TOS Violation

    Sure none of them will ever produce a super gravel but they all look awesome and will likely age better then the pastave highway.

    P.S. Sorry if I took your message out of context but I felt the need to be slightly defensive here..........


    Sent from my iPhone using Tapatalk
    LOL. I am very rarely serious on here unless it is a black and white issue. I am of course playing around. Everyone has their own preferences. I do think think the pastave highway is the prettier animal and the degree of difficulty is very high. There is no pleasing everyone. I don't like hypos or pieds. Most people do so that makes me the odd one. BEL complex is my thing though so I obviously have better taste than everyone else. ROFL

    Honestly, I like these threads and listening to people's opinions. Some of the stuff I make is for me, some for other people. So, even if I personally don't like the flavor, I learn what people like and try to make it to taste.
    Last edited by Stewart_Reptiles; 04-04-2017 at 03:40 PM.

  10. The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:

    kxr (04-04-2017),tttaylorrr (04-04-2017)

  11. #38
    BPnet Veteran kxr's Avatar
    Join Date
    12-01-2014
    Location
    Ontario, Canada
    Posts
    740
    Thanks
    414
    Thanked 462 Times in 329 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by JodanOrNoDan View Post
    LOL. I am very rarely serious on here unless it is a black and white issue. I am of course playing around. Everyone has their own preferences. I do think think the pastave highway is the prettier animal and the degree of difficulty is very high. There is no pleasing everyone. I don't like hypos or pieds. Most people do so that makes me the odd one. BEL complex is my thing though so I obviously have better taste than everyone else. ROFL

    Honestly, I like these threads and listening to people's opinions. Some of the stuff I make is for me, some for other people. So, even if I personally don't like the flavor, I learn what people like and try to make it to taste.
    Haha looks like I did misinterpret

    What do you mean the degree of difficulty is high? Like 4 genes vs 2 or maybe because gravels are harder to produce? More expensive?

    I do like hypos but I think it's a pretty common thing to dislike them. Pieds on the other hand... It seems like everyone likes them but I feel the same way as you. The only pied combos I really like are super enchi's because they have little to no white. I also love BEL complex animals but I largely prefer them in heterozygous form as opposed to homozygous.

    It's interesting that you say you try to appeal to what the market wants. I thought that was highly frowned upon lol It doesn't bother me hearing you say that but I do find the honesty surprising... I don't think I'll ever have enough space to satisfy my tastes let alone the tastes of others so I'm sticking to my own for now... Hopefully there will be a demand for what I produce but if not it's not the end of the world.


    But anyway back on topic...
    http://www.worldofballpythons.com/morphs/black-potion/

    That one's a black potion (mahogany Mojave)


    Sent from my iPhone using Tapatalk
    Last edited by Stewart_Reptiles; 04-04-2017 at 03:37 PM.

  12. The Following User Says Thank You to kxr For This Useful Post:

    tttaylorrr (04-04-2017)

  13. #39
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by kxr View Post
    Haha looks like I did misinterpret
    It's interesting that you say you try to appeal to what the market wants. I thought that was highly frowned upon lol It doesn't bother me hearing you say that but I do find the honesty surprising... I don't think I'll ever have enough space to satisfy my tastes let alone the tastes of others so I'm sticking to my own for now... Hopefully there will be a demand for what I produce but if not it's not the end of the world.
    Sent from my iPhone using Tapatalk
    Maybe think of it as being a chef. Odds are there is stuff you make that you don't like, but your customers do. My enjoyment comes from caring for the animals and producing things that make people smile. Kind of like watching kids on x-mas morning opening up some toy that they really like but you cannot figure out why. I have some butt ugly animals in my collection. They get the same treatment as all the other ones. Most of them were animals my daughters wanted. For some reason they think they are beautiful.

    As far as leopard combos go.... Deborah has some of the best I have ever seen.
    Last edited by JodanOrNoDan; 04-04-2017 at 03:03 PM.

  14. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    kxr (04-04-2017)

  15. #40
    BPnet Senior Member AbsoluteApril's Avatar
    Join Date
    03-05-2014
    Location
    Utah
    Posts
    2,080
    Thanks
    2,325
    Thanked 2,605 Times in 1,296 Posts
    be careful, I thought we aren't supposed to post photos from other sites, only list the link?
    ****
    For the Horde!

  16. The Following User Says Thank You to AbsoluteApril For This Useful Post:

    kxr (04-04-2017)

Page 4 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1