» Site Navigation
0 members and 720 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,139
Posts: 2,572,327
Top Poster: JLC (31,651)
|
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by JodanOrNoDan
I breed these combos also. I'm thinking the middle one is the 3P + enchi. the bottom is the 3p. I'm curious as to why you think otherwise?
My logic was that Enchi enhances the expression of yellow in the BluELs and has a tendency to pull the side pattern away from the dorsal stripe.
It is possible I am incorrect, no one had made PPEP before last season so I had nothing to compare to. But I really hope I am not wrong because I sold what I had labeled as the PPP
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by asplundii
My logic was that Enchi enhances the expression of yellow in the BluELs and has a tendency to pull the side pattern away from the dorsal stripe.
It is possible I am incorrect, no one had made PPEP before last season so I had nothing to compare to. But I really hope I am not wrong because I sold what I had labeled as the PPP 
I think I may have thought that too in your situation if I had not already produced one without the enchi. I wish I had a better picture of this guy right now, but he is definitely PPP. There was no enchi involved in his breeding. The picture does not show the yellow dorsal very well, but it has gotten even more yellow as he has aged. Who knows? You may be right, but even the pattern seems right. It is so flipping hard to tell when the genes start adding up.
-
-
I'm on my phone or I'd post a picture but Leopard Mojave for the win!!
Laziness is nothing more than the habit of resting before you get tired.
-
The Following 2 Users Say Thank You to StillBP For This Useful Post:
kxr (04-04-2017),tttaylorrr (04-04-2017)
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by StillBP
I'm on my phone or I'd post a picture but Leopard Mojave for the win!!
EDIT: TOS VIOLATION
http://www.worldofballpythons.com/mo...eopard-mojave/
wow, beautiful colors! that contrast tho
Last edited by Stewart_Reptiles; 04-04-2017 at 03:41 PM.
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by StillBP
I'm on my phone or I'd post a picture but Leopard Mojave for the win!!
I'll agree that its a nice animal but not even in the same class as a pastave highway.
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by JodanOrNoDan
I'll agree that its a nice animal but not even in the same class as a pastave highway.
Maybe stillbp disagrees or maybe they posted this simply because leopard Mojave hasn't been mentioned...
You're also comparing a two gene animal to a four gene animal. There are some awesome combos that have been made with Mojave leopard (just a few three and one four gene animal from WOB)
EDIT:TOS Violation
http://www.worldofballpythons.com/mo...jave-spotnose/
http://www.worldofballpythons.com/morphs/leopard-mochi/
http://www.worldofballpythons.com/mo...eopard-mojave/
http://www.worldofballpythons.com/mo...mojave-pastel/
http://www.worldofballpythons.com/mo...ojave-special/
Sure none of them will ever produce a super gravel but they all look awesome and will likely age better then the pastave highway.
P.S. Sorry if I took your message out of context but I felt the need to be slightly defensive here..........
Sent from my iPhone using Tapatalk
Last edited by Stewart_Reptiles; 04-04-2017 at 04:15 PM.
-
The Following 3 Users Say Thank You to kxr For This Useful Post:
JodanOrNoDan (04-04-2017),StillBP (04-04-2017),tttaylorrr (04-04-2017)
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by kxr
Maybe stillbp disagrees or maybe they posted this simply because leopard Mojave hasn't been mentioned...
You're also comparing a two gene animal to a four gene animal. There are some awesome combos that have been made with Mojave leopard (just a few three and one four gene animal from WOB)
EDIT: TOS Violation
Sure none of them will ever produce a super gravel but they all look awesome and will likely age better then the pastave highway.
P.S. Sorry if I took your message out of context but I felt the need to be slightly defensive here..........
Sent from my iPhone using Tapatalk
LOL. I am very rarely serious on here unless it is a black and white issue. I am of course playing around. Everyone has their own preferences. I do think think the pastave highway is the prettier animal and the degree of difficulty is very high. There is no pleasing everyone. I don't like hypos or pieds. Most people do so that makes me the odd one. BEL complex is my thing though so I obviously have better taste than everyone else. ROFL
Honestly, I like these threads and listening to people's opinions. Some of the stuff I make is for me, some for other people. So, even if I personally don't like the flavor, I learn what people like and try to make it to taste.
Last edited by Stewart_Reptiles; 04-04-2017 at 03:40 PM.
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
kxr (04-04-2017),tttaylorrr (04-04-2017)
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by JodanOrNoDan
LOL. I am very rarely serious on here unless it is a black and white issue. I am of course playing around. Everyone has their own preferences. I do think think the pastave highway is the prettier animal and the degree of difficulty is very high. There is no pleasing everyone. I don't like hypos or pieds. Most people do so that makes me the odd one. BEL complex is my thing though so I obviously have better taste than everyone else. ROFL
Honestly, I like these threads and listening to people's opinions. Some of the stuff I make is for me, some for other people. So, even if I personally don't like the flavor, I learn what people like and try to make it to taste.
Haha looks like I did misinterpret 
What do you mean the degree of difficulty is high? Like 4 genes vs 2 or maybe because gravels are harder to produce? More expensive?
I do like hypos but I think it's a pretty common thing to dislike them. Pieds on the other hand... It seems like everyone likes them but I feel the same way as you. The only pied combos I really like are super enchi's because they have little to no white. I also love BEL complex animals but I largely prefer them in heterozygous form as opposed to homozygous.
It's interesting that you say you try to appeal to what the market wants. I thought that was highly frowned upon lol It doesn't bother me hearing you say that but I do find the honesty surprising... I don't think I'll ever have enough space to satisfy my tastes let alone the tastes of others so I'm sticking to my own for now... Hopefully there will be a demand for what I produce but if not it's not the end of the world.
But anyway back on topic...
http://www.worldofballpythons.com/morphs/black-potion/
That one's a black potion (mahogany Mojave)
Sent from my iPhone using Tapatalk
Last edited by Stewart_Reptiles; 04-04-2017 at 03:37 PM.
-
The Following User Says Thank You to kxr For This Useful Post:
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by kxr
Haha looks like I did misinterpret 
It's interesting that you say you try to appeal to what the market wants. I thought that was highly frowned upon lol It doesn't bother me hearing you say that but I do find the honesty surprising... I don't think I'll ever have enough space to satisfy my tastes let alone the tastes of others so I'm sticking to my own for now... Hopefully there will be a demand for what I produce but if not it's not the end of the world.
Sent from my iPhone using Tapatalk
Maybe think of it as being a chef. Odds are there is stuff you make that you don't like, but your customers do. My enjoyment comes from caring for the animals and producing things that make people smile. Kind of like watching kids on x-mas morning opening up some toy that they really like but you cannot figure out why. I have some butt ugly animals in my collection. They get the same treatment as all the other ones. Most of them were animals my daughters wanted. For some reason they think they are beautiful.
As far as leopard combos go.... Deborah has some of the best I have ever seen.
Last edited by JodanOrNoDan; 04-04-2017 at 03:03 PM.
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
-
be careful, I thought we aren't supposed to post photos from other sites, only list the link?
-
The Following User Says Thank You to AbsoluteApril For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|