» Site Navigation
1 members and 718 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,139
Posts: 2,572,327
Top Poster: JLC (31,651)
|
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by JodanOrNoDan
I'm really liking my phantoms. Oddly enough it really kicks up the yellow in combos.
Yep! I'm going to stick mostly to the darker stuff but I definitely plan to work phantom into my bright spider stuff. Phantom spiders are really nice! Plus they pretty much remove the white sides which is nice.
Sent from my iPhone using Tapatalk
-
-
Registered User
-
-
i think the most amazing Mojave combo is Dave Green's Monsoon Mojave. i think it's one of the biggest things in BP's as much as the Scaleless and Sunset. it just looks so different.
pix - https://www.facebook.com/davegreenre...type=3&theater
and it's breeding! - https://ball-pythons.net/forums/show...Monsoon-season
can't wait to have my own one day.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 2 Users Say Thank You to Ax01 For This Useful Post:
kxr (04-03-2017),tttaylorrr (04-04-2017)
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by Ax01
No doubt! I think that monsoon is having a much greater effect on it than Mojave though... I guess we'll have to wait to see what the single gene looks like... It hasn't been produced yet has it?
The more sunset combos I see the less I like them tbh... They all look a little too similar for my liking. I'm hoping sunset clowns might change my mind but right now for me monsoon > sunset & scaleless
Sent from my iPhone using Tapatalk
Last edited by kxr; 04-03-2017 at 01:58 PM.
-
-
PurplePassion, PurplePassion Pinstripe, and PurplePassion Enchi Pinstripe


actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by Ax01
WOW what a beautiful morph!!!
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by asplundii
that PP enchi pin 😍😍😍 i really do like purple passions
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by asplundii
I breed these combos also. I'm thinking the middle one is the 3P + enchi. the bottom is the 3p. I'm curious as to why you think otherwise?
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by asplundii
 Originally Posted by JodanOrNoDan
I breed these combos also. I'm thinking the middle one is the 3P + enchi. the bottom is the 3p. I'm curious as to why you think otherwise?
have i been bamboozled!?!?! lol 
jodan, if you have a spare PPP laying around i can take it off your hands.
Last edited by tttaylorrr; 04-04-2017 at 09:52 AM.
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by tttaylorrr
have i been bamboozled!?!?! lol
jodan, if you have a spare PPP laying around i can take it off your hands.
I am a little selfish. The ones I produced last season I kept as holdbacks. The sire has repeatedly proven to have the best Phantom genes that I have personally seen. As a bonus all his offspring are large for ball pythons. I kept most of his girls from last season. At around 8 months they are already well over 1000 grams. They are going to be ready to go next season and I will be able to consistently produce PP's, PPP's, and PP Enchi combos. This season's focus was on producing Super Enchi Phantoms, Super Enchi Phantom Pins, and a lot of BEL stuff. I am also going to have more Super Mojaves than I know what to do with I think. The good news is my Phantom het lavender that I thought reabsorbed is ovulating as we speak (I am very glad to have been wrong). Puts me within a year of producing a Phantom/Lavender version of a Cherry Bomb if I get a boy. (Look out Ax, I'm catching up LOL). I love all the BEL combos. Especially the Purple Passions.
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|