» Site Navigation
1 members and 2,107 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,079
Threads: 249,221
Posts: 2,572,814
Top Poster: JLC (31,651)
|
-
Re: DNA, Chromosomes and Chimera talk
I think the closest thing you could get to something that was genetically ball python in certain parts and blood python in certain parts would have to be dual sired and BOTH a hybrid and a chimera. Chimerism really does have different genetics in different cells, but it's from two fertilized zygotes fusing. Hybridization is via the regular reproductive process so one chromosome of the pair from each, crossing over, etc.
So say you had a blood python mother mated with both a male blood python and a male ball python. Then, there were successfully zygotes from both the blood python mating and the ball python mating at the same time. These two zygotes then successfully fuse to create a chimera. That chimera would be blood/ball in some parts and pure blood python in others. One of these parts could then be the genitals. Of course, I could also buy a lottery ticket but I don't because it's pretty much not gonna happen.
1.0 Pastel yellowbelly ball python -Pipsy
2.0 Checkered garter snakes - Hazama & Relius
1.0 Dumeril's boa - Bazil
-
-
I don't know what to tell you, snarkyness begets snarkyness. You telling me how intelligent you are is doing nothing to convince me that it is true. I am only saying that an animal that looks like a ball and has what appear to be blood python genitals could exist. My first reply very directly covered every counter point you tried to make including the one where you accused my of not understanding that in simple sexual reproduction genetic material is passed from both parents even after I said several time that is not what I am saying. So again I repeat myself if this is a case of homoploid hybrid than yes genetic information is passed from both parents equally on each chromosome location. This does not mean that the animal has to look like a mix of both parents by phenotypic expression. The animal could in fact look like a ball with blood genitalia on the surface. Yes, the animal will likely look like a mix. The point of pictures were to show the variation in phenotype, and I think you know this but it does not fit your argument. Just because an animal could exist does not mean it does exist. Do I think the animal I am describing does exist? Probably not, and therefore would be asinine to try to provide "proof" of such an animal.
Your point about chimeras being fused embryos I addressed before you even stated it, but you did not catch it so I again explained it to you. Here it is again if you had two embryos carrying the information for exact opposite phenotypical animals and they combined into a chimera then you could arrive at said conclusion. For example one animal had the phenotypical genitals of a blood and the other had the body and head of a ball they could combine to create the animal we are talking about. There is no rhyme or reason how chimeras combine as every example is different I even provided an example of a woman showing was a chimera in the basic construction I proposed. Even I admitted this is a highly complicated example and probably the least likely.
The second, more interesting proposal in my opinion, is that a snake hybrid could be a case of polyploid speciation. This theory, which is by no mean one of my own, states that two species whose DNA is not compatible can create a hybrid by adding multiple choromsomes at each location. At each location the DNA of like chromosomes is used to create cells in the offspring. This essentially creates an animal that is a mosaic genetic clone of both species. If combined correctly you could actually have an animal that is part genetic ball python and part blood python. This is by no means basic genetics so please don't waste your time trying to use basic genetics to disprove this or making a powerpoint. It is not clear to me how you do not see comments like the powerpoint one as grandstanding. I provided an article that shows polyploid hybridization occurring in fish that you can refer to.
"it is absolutely not possible for an animal like the vet described to exist and I say that with absolute certainty"
"Sure, according to the laws of probability anything is possible."
So which is it, possible or not? As I have said many time I think it is possible just highly unlikely.
-
-
Re: DNA, Chromosomes and Chimera talk
 Originally Posted by Kcl
I think the closest thing you could get to something that was genetically ball python in certain parts and blood python in certain parts would have to be dual sired and BOTH a hybrid and a chimera. Chimerism really does have different genetics in different cells, but it's from two fertilized zygotes fusing. Hybridization is via the regular reproductive process so one chromosome of the pair from each, crossing over, etc.
So say you had a blood python mother mated with both a male blood python and a male ball python. Then, there were successfully zygotes from both the blood python mating and the ball python mating at the same time. These two zygotes then successfully fuse to create a chimera. That chimera would be blood/ball in some parts and pure blood python in others. One of these parts could then be the genitals. Of course, I could also buy a lottery ticket but I don't because it's pretty much not gonna happen.
I think that is another highly unlikely but possible scenario.
-
-
Re: DNA, Chromosomes and Chimera talk
I can't read the whole thing right now, but at the very least, the abstract for the below is relevant and interesting:
Diploid-triploid mosaic hybrid in dace (fish).
https://www.jstor.org/stable/1447226...n_tab_contents
1.0 Pastel yellowbelly ball python -Pipsy
2.0 Checkered garter snakes - Hazama & Relius
1.0 Dumeril's boa - Bazil
-
The Following User Says Thank You to Kcl For This Useful Post:
-
 Originally Posted by JodanOrNoDan
Awe, come on guys, debate nicely. I'm actually getting something out of your conversation.
My apologies. I accept the rebuke and will endeavor to do better
 Originally Posted by AntTheDestroyer
I don't know what to tell you, snarkyness begets snarkyness.
Glad to see you recognize this. Although I am guessing you are contending that I started this… That being the case, I suggest you go back and reread my first post in this thread which was made in an attempt to help and was completely devoid of snark. Then reread your reply to that post wherein you made smart-aleck comments. So if it is a matter of begetting then you are simply reaping what you sowed.
 Originally Posted by AntTheDestroyer
You telling me how intelligent you are is doing nothing to convince me that it is true
I never once told you how intelligent I was.
What I did was cautioning you that perhaps you should pause for a moment and realize that the person you are arguing with might know more than you on this topic. In which case it might be wise to not simply dismiss off-hand what they are saying because they might be able to teach you something. Every day I learn something from those with greater knowledge of topics than I myself have on those topics. There is no shame in admitting ignorance on a subject.
 Originally Posted by AntTheDestroyer
I am only saying that an animal that looks like a ball and has what appear to be blood python genitals could exist. My first reply very directly covered every counter point you tried to make including the one where you accused my of not understanding that in simple sexual reproduction genetic material is passed from both parents even after I said several time that is not what I am saying. So again I repeat myself if this is a case of homoploid hybrid than yes genetic information is passed from both parents equally on each chromosome location.
I did not make the accusation you outline here. This has very little to do with how the genetic information is passed from parent to offspring and much more to do with subsequent parsing and passaging of that genetic information, cell by cell, in the development of the embryo – That is where you seem to be misunderstanding things
 Originally Posted by AntTheDestroyer
Your point about chimeras being fused embryos I addressed before you even stated it, but you did not catch it so I again explained it to you.
No, I caught exactly what you said which is why I said you seemed to be confused. And I gave the 60 second correction because I thought you had enough of a grip on the topic to see how I was redirecting you.
 Originally Posted by AntTheDestroyer
Here it is again if you had two embryos carrying the information for exact opposite phenotypical animals and they combined into a chimera then you could arrive at said conclusion. For example one animal had the phenotypical genitals of a blood and the other had the body and head of a ball they could combine to create the animal we are talking about.
I did not need it again but this just further tells me you are confused. You are describing a chimera event as if it were something like a simple monogenetic morph and you could have a “normal” looking animal that had “Albino” genitals.
That is NOT how chimerism works.
 Originally Posted by AntTheDestroyer
There is no rhyme or reason how chimeras combine as every example is different
There actually is some degree of rhyme and reason for how chimera combine when you are talking about the ones in the cases you are trying to use as your argument.
 Originally Posted by AntTheDestroyer
I even provided an example of a woman showing was a chimera in the basic construction I proposed.
Your argument citing the woman does not support your case though, because, again, you are looking at it the wrong way. Quite simply put, your citation of the woman is irrelevant as an argument because you are trying to compare apples to oranges. Human chimeras are composed of exclusively human genetic material. They are not hybrids. As such, you cannot use these examples as an argumentative basis when the topic at hand is a hybrid.
For your argument to be relevant you would need to be citing an example of some type of human x NHP hybrid, say a gorilla (which, thanks be to ethical scientists, does not exist). Then, you would need to further cite cases of chimerism in such a hybrid.
If we were to reword your argument then so that it fit the above criteria then what you are contending is that it is possible to produce, through a primary specimen breeding of human x gorilla, an offspring that was 100% genetically and phenotypically female human on the outside while being 100% genetically and phenotypically male gorilla on the inside including having testes and penis internally replacing ovaries and uterus.
Or, using apples and oranges to take the argument to an extreme with hyperbole, the human woman chimera you keep citing is an apple/apple mix that is still apple through and through whereas a ball/blood hybrid/chimera would be an apple/orange mix that you are arguing would look exactly like an apple on the outside but actually be an orange inside when you cut it open.
Now, I do not know how anyone could read either of those two statements and NOT think that their conclusions are utterly and ridiculously preposterous. And yet that is exactly what you are trying to argue when you say it is possible to have a ball/blood hybrid/chimera that is a ball on the outside and a blood on the inside. Regardless of the hand-waving you might try, genetics simply does not work that way.
 Originally Posted by AntTheDestroyer
The second, more interesting proposal in my opinion, is that a snake hybrid could be a case of polyploid speciation. This theory, which is by no mean one of my own, states that two species whose DNA is not compatible can create a hybrid by adding multiple choromsomes at each location. At each location the DNA of like chromosomes is used to create cells in the offspring. This essentially creates an animal that is a mosaic genetic clone of both species. If combined correctly you could actually have an animal that is part genetic ball python and part blood python.
This is not quite how polyploidy works.
Polyploidy in an imbalance situation is corrected by a whole genome duplication, going from 2n+1 to 4n+2 and thereby allowing for balanced chromosome segregation during subsequent cell division. And while, yes, this does mean there is a single chromosome bias from one of the parents, that does not mean that entire regions of the polyploid hybrid would then revert to only expression of all of the genes from that one parent and no expression from the other parent.
 Originally Posted by AntTheDestroyer
This is by no means basic genetics so please don't waste your time trying to use basic genetics to disprove this or making a powerpoint. It is not clear to me how you do not see comments like the powerpoint one as grandstanding.
But it is basic genetics and the PowerPoint, by using pictures -- which I often find are more clear that words alone -- could help to illustrate that. And so, by making comments about how I could make things clearer to understand I am not, by any stretch of the imagination, grandstanding. Despite your accusations to the contrary
 Originally Posted by AntTheDestroyer
I provided an article that shows polyploid hybridization occurring in fish that you can refer to.
I never attested that polyploid hybridization did not occur, in fact, I am quite well aware of it occurring. Nor is it particularly relevant to the conversation except in being an interesting read.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|