» Site Navigation
0 members and 1,924 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,079
Threads: 249,221
Posts: 2,572,814
Top Poster: JLC (31,651)
|
-
Registered User
Re: That's a new one...the things a "reptile" vet will say...
 Originally Posted by AntTheDestroyer
You are probably right polyploidy is unlikely but until it is proven that this mechanism is not the way snake hybrids are created it still is a possibly. The number of chromosomes a parent species has does not effect if the hybrid is formed by homoploid or polyploid processes. I believe in some polyploid situations after meiosis the number of chromosome is returned to the same amount as the two parent species, that is of course if they have the same number. Again it is unlikely that it is polyploidy but I am not certain the research exists to say how hybrid snakes are formed to say one way or another.
Except it can and has been proven. When polyploidy occurs in a diploid animal, that animal is infertile. Hybrid snakes have been able to reproduce. Thus it can not be polyploidy.
If snakes have pairs of chromosomes, and each parent gives one chromosome, the offspring has one set inherited from each parent. This means that it has one pair of each chromosome. Nowhere could it become polyploid. The number of chromosomes a parent has certainly does affect how the offspring is formed.
Sent from my iPhone using Tapatalk
-
-
Re: That's a new one...the things a "reptile" vet will say...
 Originally Posted by Yamitaifu
Except it can and has been proven. When polyploidy occurs in a diploid animal, that animal is infertile. Hybrid snakes have been able to reproduce. Thus it can not be polyploidy.
If snakes have pairs of chromosomes, and each parent gives one chromosome, the offspring has one set inherited from each parent. This means that it has one pair of each chromosome. Nowhere could it become polyploid. The number of chromosomes a parent has certainly does affect how the offspring is formed.
Sent from my iPhone using Tapatalk
Saying that polyploids in diploid leads to infertility is just plain false. About 50 percent of women with down syndrom are fertile. Even in a case of polyploidy of sex chromosomes, as is the case with Klinefelters syndrome a small percent are fertile for the majority of their life.
You are confusing the process of diploid sexual reproduction in the same species versus that between seperate species where the DNA is not necessarily compatible. You need to look into the difference between polyploid speciation and homoploid speciation. Then please get back to me.
I think I have taken this thread about as far off topic as I can, and it is beginning to seem disrespectful to the OP so I would encourage anyone who would like to continue this line of conversation to pm me.
-
The Following User Says Thank You to AntTheDestroyer For This Useful Post:
-
by all means, go on and continue, I don't mind 
I'm fascinated by all that info, but I have to say, I'm starting to get really lost, LOL.
Still interesting to read about it.
Zina
0.1 Super Emperor Pinstripe Ball Python "Sunny" 0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna" 0.1 Pastel Desert Ghost Ball Python "Arjanam" 0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora" 0.1 Pastel Enchi Desert Ghost Ball Python "Venus" 1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius" 1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"
"It is only with the heart that one can see rightly; what is essential is invisible to the eye." - Antoine de Saint-ExupÈry
-
-
Alright, as long as you are good with it.
-
-
Registered User
Re: That's a new one...the things a "reptile" vet will say...
 Originally Posted by AntTheDestroyer
Saying that polyploids in diploid leads to infertility is just plain false. About 50 percent of women with down syndrom are fertile. Even in a case of polyploidy of sex chromosomes, as is the case with Klinefelters syndrome a small percent are fertile for the majority of their life.
You are confusing the process of diploid sexual reproduction in the same species versus that between seperate species where the DNA is not necessarily compatible. You need to look into the difference between polyploid speciation and homoploid speciation. Then please get back to me.
I think I have taken this thread about as far off topic as I can, and it is beginning to seem disrespectful to the OP so I would encourage anyone who would like to continue this line of conversation to pm me.
Down syndrome is not a case of polyploidy though. It is trisomy, a form of aneuploidy.
"The distinction between aneuploidy and polyploidy is that aneuploidy refers to a numerical change in part of the chromosome set, whereas polyploidy refers to a numerical change in the whole set of chromosomes."
Sent from my iPhone using Tapatalk
-
-
So it your contention that a aneuploid would not be infertile but a polyploid would? It is pretty commonly accepted that uneven numbers of chromosomes are more likely lead to infertility than even ones.
Here is an article that describes a triploid hybrid from two diploid species of fish. Not only that but they can reproduce asexually as well as sexually. That sounds far from infertile to me.
https://www.google.com/url?sa=t&sour...9N_h6h04dTjpPA
-
-
Re: That's a new one...the things a "reptile" vet will say...
 Originally Posted by AntTheDestroyer
Speaking in absolutes is neither scientific or advisable.
Oh, we are going to go there are we?
Sure, according to the laws of probability anything is possible. But while there is a minuscule probability of jumping from the top of Burj Khalifa and living I can absolutely guarantee that actually going and doing it means you will die. Because science (aka gravity) says you will
 Originally Posted by AntTheDestroyer
I am aware is comprised of genetic material of both parents but that does not mean it will share the phenotype of both or either.
And yet your argument is that it is possible to do exactly that. In a somehow anatomically/spatially selective manner.
 Originally Posted by AntTheDestroyer
We are talking about the inheritance of said trait so the chromosome is molecule I am focused on.
No, we are talking about collective genomic inheritance and expression. A hybrid will inherit a full compliment of chromosomes from each parent and so each [somatic] cell will carry both sets of chromosomes and, with some few exceptions, all of the genes from both parents will be expressed in those cells.
You will never get a hybrid where the "outside" cells are made up exclusively of only ball python chromosome cells and the "inside" cells are made up exclusively of only blood python chromosome cells. It absolutely, fundamentally cannot happen.
 Originally Posted by AntTheDestroyer
I can not explain every minute detail about the entire genetic science
Yes well... I can explain genetics in minute detail 
 Originally Posted by Yamitaifu
When polyploidy occurs in a diploid animal, that animal is infertile. Hybrid snakes have been able to reproduce. Thus it can not be polyploidy.
 Originally Posted by AntTheDestroyer
Saying that polyploids in diploid leads to infertility is just plain false.
Careful there Ant, you do not want to go speaking in absolutes because that is neither scientific or advisable... 
Fact of the matter is that you are both right and both wrong. While polyploidy most often does result in infertile offspring there are documented cases of fertile polyploids that have occurred, generally leading to a speciation event. Some quick examples that come to mind are the Grey and Cope's Grey treefrog and the horned frogs Ceratophrys cranwelli and C. ornata along with more blatant examples like the wheat and corn that humans have cultivated for centuries.
The long and the short of it is that, regardless of whatever mystical hand waving you want to try throwing at it, what the vet claimed is simply not possible.
Last edited by asplundii; 03-31-2017 at 08:37 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: That's a new one...the things a "reptile" vet will say...
 Originally Posted by asplundii
Oh, we are going to go there are we?
Sure, according to the laws of probability anything is possible. But while there is a minuscule probability of jumping from the top of Burj Khalifa and living I can absolutely guarantee that actually going and doing it means you will die. Because science (aka gravity) says you will
And yet your argument is that it is possible to do exactly that. In a somehow anatomically/spatially selective manner.
No, we are talking about collective genomic inheritance and expression. A hybrid will inherit a full compliment of chromosomes from each parent and so each [somatic] cell will carry both sets of chromosomes and, with some few exceptions, all of the genes from both parents will be expressed in those cells.
You will never get a hybrid where the "outside" cells are made up exclusively of only ball python chromosome cells and the "inside" cells are made up exclusively of only blood python chromosome cells. It absolutely, fundamentally cannot happen.
Yes well... I can explain genetics in minute detail
Careful there Ant, you do not want to go speaking in absolutes because that is neither scientific or advisable...
Fact of the matter is that you are both right and both wrong. While polyploidy most often does result in infertile offspring there are documented cases of fertile polyploids that have occurred, generally leading to a speciation event. Some quick examples that come to mind are the Grey and Cope's Grey treefrog and the horned frogs Ceratophrys cranwelli and C. ornata along with more blatant examples like the wheat and corn that humans have cultivated for centuries.
The long and the short of it is that, regardless of whatever mystical hand waving you want to try throwing at it, what the vet claimed is simply not possible.
...And yet people have survived jumping out of plains so it not impossible just highly unlikely. This is a perfect example of a straw man argument.
My argument is that you could have something that looks like a ball python on the outside and has reproductive organs that appear to be from a blood python. I provided the way it could be possible just by phenotypic expression, the more likely option, and by actual genetic make up. The second is a bit of a stretch, but not impossible. I will leave it you to try to specifically refute them.
No you did not explain every minute detail, because that would be insanely tedius. That was my point. Secondly no you can not as not every thing about genetic inheritance is fully understood, by the human race at least. Maybe you are some sort of omnicent being, then I will eat my words.
He made the statement that all diploids that becone polyploids are infertile and i provided proof that was not true. I never said that all polyploids are fertile. So where did I speak in absolutes?
Did you come here to make grandstands or talk about genetics? If it is the latter I would be interested in hearing where you think I am wrong, with in genetic possibility. The only part of your post that had substance was the last section and unfortunately you didn't go into much detail. Yes i am talking about things that are highly unlikely, but that is a far stretch from impossible. Science was once considered magic.
Last edited by AntTheDestroyer; 03-31-2017 at 10:28 AM.
RAD House Reptiles
-
-
Re: That's a new one...the things a "reptile" vet will say...
 Originally Posted by AntTheDestroyer
...And yet people have survived jumping out of plains so it not impossible just highly unlikely. This is a perfect example of a straw man argument.
And here I was talking about a very specific set of conditions that had not one thing to do with airplanes and you bring up airplanes… So strawman right back at you.
 Originally Posted by AntTheDestroyer
My argument is that you could have something that looks like a ball python on the outside and has reproductive organs that appear to be from a blood python. I provided the way it could be possible just by phenotypic expression, the more likely option, and by actual genetic make up.
You provided a cherry-picked bad picture as proof and even in that bad picture you can see the animal is not a pure ball. And if you have ever had hands on a ball/blood hybrid there is simply no way you could confuse it as being a ball.
As for the genetic make-up… You have not provided anything close to proof. Proof would be an actual documented genetic mechanism. All you have provided is rampant speculation built off of a topic in genetics that most people in the hobby do not understand nearly as well as they would like to think they do.
 Originally Posted by AntTheDestroyer
The second is a bit of a stretch, but not impossible. I will leave it you to try to specifically refute them.
I already did refute them. Twice. You have pointedly ignored my refutations.
 Originally Posted by AntTheDestroyer
No you did not explain every minute detail
I said that I could I did not say that I had.
 Originally Posted by AntTheDestroyer
because that would be insanely tedius.
Yes, it will be tedious since it appears that I am going to have to create a full set of PowerPoint slides so I can convert them into .jpg thereby allowing me to deliver a full on lecture about what is basic genetics and cell biology.
 Originally Posted by AntTheDestroyer
Secondly no you can not as not every thing about genetic inheritance is fully understood, by the human race at least.
No, everything about genetic inheritance is not fully known. But the bare basics are and this is a bare basics situation.
 Originally Posted by AntTheDestroyer
Maybe you are some sort of omnicent being, then I will eat my words.
Ahhh... Snark. I enjoy snark (ad hominem attack much??)
No, I am not omniscient. However, between the two of us I would posit that there is the distinct probability that I just might know a little bit more about genetics than you do…
 Originally Posted by AntTheDestroyer
Did you come here to make grandstands or talk about genetics?
I am talking genetics, but if you want to accuse me of grandstanding (hey look, another ad hominem attack) rather than actually refuting the legitimate genetics I have put forth then please, go right ahead.
If I have the free time and the boredom I will make up the slide I mentioned above and then I will slip into full on lecture mode. However, right now I have finished eating lunch so I have other duties to attend to
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Awe, come on guys, debate nicely. I'm actually getting something out of your conversation.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|