Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 741

0 members and 741 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 35
  1. #11
    BPnet Veteran AntTheDestroyer's Avatar
    Join Date
    11-23-2015
    Location
    Denver
    Posts
    333
    Thanks
    17
    Thanked 176 Times in 81 Posts
    My point was not that this animal was in fact a hybrid just that there is a possibility, if not very small, of the animal the vet described could exist in real life. An exercise in pointlessness? Possibly, but interesting to me at least. Truthfully I do not believe any trained vet would say this even if they didn't know much about snakes, and I am not saying your acquaintance is a liar either. I think this is more likely due to a miscommunication, as I said earlier. Let her know she is welcome and that we all had to start somewhere.
    RAD House Reptiles

  2. #12
    BPnet Lifer zina10's Avatar
    Join Date
    08-09-2010
    Location
    southeast
    Posts
    4,573
    Thanks
    5,693
    Thanked 6,185 Times in 2,610 Posts

    Re: That's a new one...the things a "reptile" vet will say...

    Quote Originally Posted by AntTheDestroyer View Post
    My point was not that this animal was in fact a hybrid just that there is a possibility, if not very small, of the animal the vet described could exist in real life. An exercise in pointlessness? Possibly, but interesting to me at least. Truthfully I do not believe any trained vet would say this even if they didn't know much about snakes, and I am not saying your acquaintance is a liar either. I think this is more likely due to a miscommunication, as I said earlier. Let her know she is welcome and that we all had to start somewhere.
    so, just out of curiosity...would the poodle/bulldog scenario be possible, just in theory ?
    Last edited by zina10; 03-30-2017 at 12:34 AM.
    Zina

    0.1 Super Emperor Pinstripe Ball Python "Sunny"
    0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna"
    0.1 Pastel Desert Ghost Ball Python "Arjanam"
    0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora"
    0.1 Pastel Enchi Desert Ghost Ball Python "Venus"
    1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius"
    1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"

    "It is only with the heart that one can see rightly; what is essential is invisible to the eye."
    - Antoine de Saint-ExupÈry

  3. #13
    BPnet Veteran AntTheDestroyer's Avatar
    Join Date
    11-23-2015
    Location
    Denver
    Posts
    333
    Thanks
    17
    Thanked 176 Times in 81 Posts

    Re: That's a new one...the things a "reptile" vet will say...

    Quote Originally Posted by zina10 View Post
    so, just out of curiosity...would the poodle/bulldog scenario be possible, just in theory ?
    I am not going to say it is impossible, but certainly even less likely. Some of the processes I am referring to only apply to hybrids of different species, which a poodle and a bulldog are not. Truthfully I am not as well versed on dog genetics.
    Last edited by AntTheDestroyer; 03-30-2017 at 12:58 AM.
    RAD House Reptiles

  4. #14
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: That's a new one...the things a "reptile" vet will say...

    Quote Originally Posted by AntTheDestroyer View Post
    I am aware the genetics are mixed code from each parent in a chimera, but phenotypic expression is not necessarily. Phenotype is what we are talking about in this situation, no? I explained my train of thought with different looking siblings being combined into a chimera, so I am not sure why you are still bringing up mixed genetic code. Am I missing something?
    I bring it up because I have yet to see hybrids in the animal kingdom where one species completely dominants over the other as being suggested. Even if there is, there's plenty of super balls that show what to expect, even the one you just posted.
    Quote Originally Posted by AntTheDestroyer View Post
    It could be that no one is advertising the more plain hatchlings. Here is a mix that is exactly opposite of what you have described head of a blood, pattern of a ball. http://s218.photobucket.com/user/abi...rball.jpg.html
    The picture is too low quality to pick out any features but even looking through the grain the head shape (I should of been more specific) looks more ball than blood to me. And even at that low quality it is still very obvious it is a hybrid even just looking at the body.

    Quote Originally Posted by AntTheDestroyer View Post
    Diploid means two chromosomes, one from each parent containing genetic code or DNA. Each chromosome is composed of two strands of DNA so that means four DNA to a set. Polyploid is having more than a single set from each parent, usually double so 4 chromosomes or 8 strands of DNA. Out of the 4 one matching pair is allowed to pair during meiosis creating essentially cloned DNA, but each chromosome pair is not from the same parent. It may be unlikely that this is possible because it is thought that homoploid hybrids are more common in animals, but not many studies have been done on hybrid genetics in animals.
    I still don't see how this give the possibility suggested.

  5. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: That's a new one...the things a "reptile" vet will say...

    Quote Originally Posted by AntTheDestroyer View Post
    My point was not that this animal was in fact a hybrid just that there is a possibility, if not very small, of the animal the vet described could exist in real life.
    Ant,

    Reading all of your replies it seems you are somewhat confused about how the genetics of chimeras work even after OWAL's attempts to clear it up. Perhaps I might have more success.

    First off, no, it is absolutely not possible for an animal like the vet described to exist and I say that with absolute certainty. You cannot have a hybrid that is genetically/phenotypically ball python on the outside and genetically/phenotypically blood python on the inside.

    A chimera comes about from the the fusion of two embryos in the womb. The embryos have different genotypes and so, when a chimera is sampled by both skin sample and blood sample, the two samples come back as being different. However, both samples come back as being from the same mother and father, which is to say the samples look like they came from siblings, despite the fact that they came from a single individual. The samples do not come back looking like two wholly unrelated entities.

    So... If you had a ball/blood hybrid and if it were a chimera, it would look exactly like a normal ball/blood hybrid on the outside and on the inside and the only way you could tell it was a chimera would be by genetic testing and not by popping it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    kxr (03-30-2017)

  7. #16
    BPnet Veteran AntTheDestroyer's Avatar
    Join Date
    11-23-2015
    Location
    Denver
    Posts
    333
    Thanks
    17
    Thanked 176 Times in 81 Posts

    Re: That's a new one...the things a "reptile" vet will say...

    Truthfully how many super ball clutches have you seen? Here is one that could be easily confused for a ball by someone with little experience
    I have seen some T. radix hybrids that look exactly like their parent, and isn't this the thing the entire anti hybrid crowd base their hysteria off of? In a polyploid situation you end up with the genetic information translated my mieosis from that specific pair is an exact copy of the parents dna. If the chromosome that codes for exterior looks is ball and the chromosome that codes for internal organs is blood then you end up with the situation the vet described. We are talking about a very specific combination that would likely not pop up often, and in general you would end up with animals that is a mix of the species.

    Quote Originally Posted by OhhWatALoser View Post
    Perhaps we should dial back to the original topic, what is the difference between ball and blood genitalia?
    I hear you and I admit that I don't know much about snake genitalia. It seems pretty hard to find pictures of blood python hemipenes. I think it would more strange if they were identical based off my experience with biology.
    RAD House Reptiles

  8. #17
    Registered User Yamitaifu's Avatar
    Join Date
    09-23-2013
    Location
    PA
    Posts
    145
    Thanks
    9
    Thanked 64 Times in 34 Posts
    Images: 1

    Re: That's a new one...the things a "reptile" vet will say...

    Quote Originally Posted by AntTheDestroyer View Post
    Truthfully how many super ball clutches have you seen? Here is one that could be easily confused for a ball by someone with little experience
    I have seen some T. radix hybrids that look exactly like their parent, and isn't this the thing the entire anti hybrid crowd base their hysteria off of? In a polyploid situation you end up with the genetic information translated my mieosis from that specific pair is an exact copy of the parents dna. If the chromosome that codes for exterior looks is ball and the chromosome that codes for internal organs is blood then you end up with the situation the vet described. We are talking about a very specific combination that would likely not pop up often, and in general you would end up with animals that is a mix of the species.


    I hear you and I admit that I don't know much about snake genitalia. It seems pretty hard to find pictures of blood python hemipenes. I think it would more strange if they were identical based off my experience with biology.
    This isn't a situation involving polyploidy. As far as we know all snakes have 36 pairs of chomosomes: 20 micro, 36 macro. Hybrids between python species occur successfully so often because of the similarities. Many of them are even fertile.

    And its not the chromosome as one whole that codes for traits, its the alleles on the chromosomes that do. There are very many alleles that go into each trait that an organism possesses. Some hybrids may look more or less like one of the parents, but that goes for any organism, including those that are not hybrids.

    And its highly likely that most python species have very similar hemipenes. Given that many can interbreed successfully and produce fertile offspring the reproductory organs must be similar.

    I hope that this made some sense. If any of it is unclear or anybody has a question let me know!


    Sent from my iPhone using Tapatalk

  9. The Following User Says Thank You to Yamitaifu For This Useful Post:

    zina10 (03-30-2017)

  10. #18
    BPnet Veteran AntTheDestroyer's Avatar
    Join Date
    11-23-2015
    Location
    Denver
    Posts
    333
    Thanks
    17
    Thanked 176 Times in 81 Posts

    Re: That's a new one...the things a "reptile" vet will say...

    Quote Originally Posted by asplundii View Post
    Ant,

    Reading all of your replies it seems you are somewhat confused about how the genetics of chimeras work even after OWAL's attempts to clear it up. Perhaps I might have more success.

    First off, no, it is absolutely not possible for an animal like the vet described to exist and I say that with absolute certainty. You cannot have a hybrid that is genetically/phenotypically ball python on the outside and genetically/phenotypically blood python on the inside.

    A chimera comes about from the the fusion of two embryos in the womb. The embryos have different genotypes and so, when a chimera is sampled by both skin sample and blood sample, the two samples come back as being different. However, both samples come back as being from the same mother and father, which is to say the samples look like they came from siblings, despite the fact that they came from a single individual. The samples do not come back looking like two wholly unrelated entities.

    So... If you had a ball/blood hybrid and if it were a chimera, it would look exactly like a normal ball/blood hybrid on the outside and on the inside and the only way you could tell it was a chimera would be by genetic testing and not by popping it.
    No I am aware that a chimera is a fusion of two embryos, which is why I said "As we see in snakes you can actually get offspring that resemble each parent, which is why I went with the chimera theory". Meaning that it could be a Chimera between two phenotypically opposite animals. I think OWAL caught this. After thinking about it more I was over complicating the possibility and there are even other ways you can create this snake. Speaking in absolutes is neither scientific or advisable. As I already told OWAL I am aware is comprised of genetic material of both parents but that does not mean it will share the phenotype of both or either.
    RAD House Reptiles

  11. #19
    BPnet Veteran AntTheDestroyer's Avatar
    Join Date
    11-23-2015
    Location
    Denver
    Posts
    333
    Thanks
    17
    Thanked 176 Times in 81 Posts

    Re: That's a new one...the things a "reptile" vet will say...

    Quote Originally Posted by Yamitaifu View Post
    This isn't a situation involving polyploidy. As far as we know all snakes have 36 pairs of chomosomes: 20 micro, 36 macro. Hybrids between python species occur successfully so often because of the similarities. Many of them are even fertile.

    And its not the chromosome as one whole that codes for traits, its the alleles on the chromosomes that do. There are very many alleles that go into each trait that an organism possesses. Some hybrids may look more or less like one of the parents, but that goes for any organism, including those that are not hybrids.

    And its highly likely that most python species have very similar hemipenes. Given that many can interbreed successfully and produce fertile offspring the reproductory organs must be similar.

    I hope that this made some sense. If any of it is unclear or anybody has a question let me know!


    Sent from my iPhone using Tapatalk
    You are probably right polyploidy is unlikely but until it is proven that this mechanism is not the way snake hybrids are created it still is a possibly. The number of chromosomes a parent species has does not effect if the hybrid is formed by homoploid or polyploid processes. I believe in some polyploid situations after meiosis the number of chromosome is returned to the same amount as the two parent species, that is of course if they have the same number. Again it is unlikely that it is polyploidy but I am not certain the research exists to say how hybrid snakes are formed to say one way or another.
    Last edited by AntTheDestroyer; 03-30-2017 at 02:28 PM.
    RAD House Reptiles

  12. #20
    BPnet Veteran AntTheDestroyer's Avatar
    Join Date
    11-23-2015
    Location
    Denver
    Posts
    333
    Thanks
    17
    Thanked 176 Times in 81 Posts
    A chromosome carries the DNA that hold an allele from parent to offspring. We are talking about the inheritance of said trait so the chromosome is molecule I am focused on. I can not explain every minute detail about the entire genetic science, nor do people want to listen to that.
    Last edited by AntTheDestroyer; 03-30-2017 at 02:46 PM.
    RAD House Reptiles

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1