» Site Navigation
1 members and 311 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,083
Threads: 249,223
Posts: 2,572,821
Top Poster: JLC (31,651)
|
-
Atomic gene = Paradox?
So I've been noticing on Morphmarket that a lot of snakes are popping up with a paradox effect. I know most people say that its not genetic but I just watched a YouTube video that said some guy is working with the Atomic gene. Apparently it's a recessive gene and when mixed with other genes it causes a paradox effect. Maybe it's actually in some of the paradox snakes that I see that are unexplained? I wonder how many people have tried to prove out their paradox thinking it may be recessive? Maybe the Atomic gene is already out there all over the place and everyone just calls it 'Paradox'. It would be interesting to pick up a handful of paradox ball pythons and breed them together and see what happens...
-
-
Mike Wilbanks was the originator of the Atomic project last time i checked and it sort of fell under the radar for years until now. Apparently it's recessive but very little information has been released on it in a very long time so take that how you will.
-
The Following User Says Thank You to Seven-Thirty For This Useful Post:
-
I also doubt Mike has released enough stock, if any, for the gene to be out there unknown to people. Paradoxing is such a desirable trait that I doubt very many who purchase or produce them don't at least try to prove it out. Non genetic paradoxing is pretty well documented, especially with certain morphs. I think in reality it is unlikely these cases are somehow genetc.
-
The Following User Says Thank You to AntTheDestroyer For This Useful Post:
-
Re: Atomic gene = Paradox?
Yep, before the atomic gene was introduced many people produced paradoxes and attempted to prove them out with no successes. There are other genes known to create paradoxing as well but in different ways. Both champagne and het pied commonly throw paradoxing in the form of "ringers". Another newer gene called whitewash I believe (maybe whiteout) also seems to create a form of paradoxing although it is also different from that created by the atomic gene.
On one of the podcasts Mike was on he stated that for awhile he thought the atomic gene was like the banana gene in that it threw odd sex ratios. For the longest time he was only getting females and that is likely why it's taken so long for him to figure it out.
Sent from my iPhone using Tapatalk
-
-
Re: Atomic gene = Paradox?
 Originally Posted by kxr
Both champagne and het pied commonly throw paradoxing in the form of "ringers".
"Ringers" are not paradoxing...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Atomic gene = Paradox?
 Originally Posted by asplundii
"Ringers" are not paradoxing...
I thought that you mentioned in one of the royally addicted podcasts that they were. Oh well, I guess I misinterpreted you
Sent from my iPhone using Tapatalk
-
-
Let me clarify, I recall you talking about champagne and another gene (it might not have been pied) and how they commonly threw an anomaly because of how they mess up the pigment distribution in the animal. I could be remembering incorrectly but I thought the topic of the conversation was paradoxing and I just assumed you were taking about the ringers.
-
-
Re: Atomic gene = Paradox?
 Originally Posted by kxr
Let me clarify, I recall you talking about champagne and another gene (it might not have been pied) and how they commonly threw an anomaly because of how they mess up the pigment distribution in the animal. I could be remembering incorrectly but I thought the topic of the conversation was paradoxing and I just assumed you were taking about the ringers.
I did have a brief bit on HNR was about Champs and het Pied acting in a synergistic manner causing high expression ringers but that is different than paradoxing. Paradoxing comes about through a situation where the cells in the paradox region are genetically dissimilar to the cells in the rest of the animal (primarily through mosaicism or chimerism). Ringers are, as you note, a result of a disruption in pigment distribution -- the genetic make up of the cells in the ringer area is the same as the genetic make up of the cells in the rest of the animal, it is just that their expression program is nurked
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|